MACROD2 (NM_001033087) Human Untagged Clone
CAT#: SC302700
MACROD2 (untagged)-Human MACRO domain containing 2 (MACROD2), transcript variant 2
"NM_001033087" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MACROD2 |
Synonyms | C2orf133; C20orf133 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001033087, the custom clone sequence may differ by one or more nucleotides
ATGAATGAGTTTTTCTCCGTAGACGATAATAATGAAGAAGAAGAGGATGTTGAAATGAAAGAAGATTCAG ATGAGAACGGTCCAGAGGAGAAGCAAAGTGTGGAAGAAATGGAAGAGCAGAGCCAAGATGCAGATGGTGT CAACACTGTCACTGTGCCCGGCCCTGCTTCAGAAGAGGCAGTTGAAGACTGTAAAGATGAAGATTTTGCA AAGGATGAAAATATTACAAAAGGCGGTGAAGTGACAGATCATTCTGTGCGTGACCAAGATCATCCCGATG GACAAGAGAATGATTCAACGAAGAATGAAATAAAAATTGAAACAGAATCGCAGAGCTCATATATGGAAAC AGAAGAACTTTCATCAAACCAAGAAGATGCCGTGATTGTGGAGCAACCAGAAGTGATTCCATTAACAGAG GACCAAGAAGAAAAAGAAGGTGAAAAAGCTCCAGGCGAGGACACACCTAGGATGCCTGGGAAAAGTGAAG GCTCCAGTGACCTAGAAAATACTCCAGGTCCTGATGTTGAAATGAATAGTCAGGTTGACAAGGTAAATGA CCCAACAGAGAGTCAACAAGAAGATCAACTAATAGCAGGGGCACAAGATGAAGCGAAGGAACAAAGAAAT GGAACTAAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001033087 |
ORF Size | 642 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001033087.1, NP_001028259.1 |
RefSeq Size | 4425 |
RefSeq ORF | 642 |
Locus ID | 140733 |
Gene Summary | The protein encoded by this gene is a deacetylase involved in removing ADP-ribose from mono-ADP-ribosylated proteins. The encoded protein has been shown to translocate from the nucleus to the cytoplasm upon DNA damage. [provided by RefSeq, May 2017] Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 3. The resulting isoform (2) is shorter at the N-terminus compared to isoform 3. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215636 | MACROD2 (Myc-DDK-tagged)-Human MACRO domain containing 2 (MACROD2), transcript variant 2 |
USD 98.00 |
|
RG215636 | MACROD2 (GFP-tagged) - Human MACRO domain containing 2 (MACROD2), transcript variant 2 |
USD 460.00 |
|
RC215636L1 | Lenti ORF clone of Human MACRO domain containing 2 (MACROD2), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC215636L2 | Lenti ORF clone of Human MACRO domain containing 2 (MACROD2), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC215636L3 | Lenti ORF clone of Human MACRO domain containing 2 (MACROD2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC215636L4 | Lenti ORF clone of Human MACRO domain containing 2 (MACROD2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review