MACROD2 (NM_001033087) Human Untagged Clone

CAT#: SC302700

MACROD2 (untagged)-Human MACRO domain containing 2 (MACROD2), transcript variant 2


  "NM_001033087" in other vectors (6)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MACROD2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MACROD2
Synonyms C2orf133; C20orf133
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001033087, the custom clone sequence may differ by one or more nucleotides


ATGAATGAGTTTTTCTCCGTAGACGATAATAATGAAGAAGAAGAGGATGTTGAAATGAAAGAAGATTCAG
ATGAGAACGGTCCAGAGGAGAAGCAAAGTGTGGAAGAAATGGAAGAGCAGAGCCAAGATGCAGATGGTGT
CAACACTGTCACTGTGCCCGGCCCTGCTTCAGAAGAGGCAGTTGAAGACTGTAAAGATGAAGATTTTGCA
AAGGATGAAAATATTACAAAAGGCGGTGAAGTGACAGATCATTCTGTGCGTGACCAAGATCATCCCGATG
GACAAGAGAATGATTCAACGAAGAATGAAATAAAAATTGAAACAGAATCGCAGAGCTCATATATGGAAAC
AGAAGAACTTTCATCAAACCAAGAAGATGCCGTGATTGTGGAGCAACCAGAAGTGATTCCATTAACAGAG
GACCAAGAAGAAAAAGAAGGTGAAAAAGCTCCAGGCGAGGACACACCTAGGATGCCTGGGAAAAGTGAAG
GCTCCAGTGACCTAGAAAATACTCCAGGTCCTGATGTTGAAATGAATAGTCAGGTTGACAAGGTAAATGA
CCCAACAGAGAGTCAACAAGAAGATCAACTAATAGCAGGGGCACAAGATGAAGCGAAGGAACAAAGAAAT
GGAACTAAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001033087
ORF Size 642 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001033087.1, NP_001028259.1
RefSeq Size 4425
RefSeq ORF 642
Locus ID 140733
Gene Summary The protein encoded by this gene is a deacetylase involved in removing ADP-ribose from mono-ADP-ribosylated proteins. The encoded protein has been shown to translocate from the nucleus to the cytoplasm upon DNA damage. [provided by RefSeq, May 2017]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 3. The resulting isoform (2) is shorter at the N-terminus compared to isoform 3.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.