CSTF3 (NM_001033505) Human Untagged Clone

CAT#: SC302707

CSTF3 (untagged)-Human cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (CSTF3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CSTF3
• Synonyms: CSTF-77
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001033505, the custom clone sequence may differ by one or more nucleotides
  ATGTCAGGAGACGGAGCCACGGAGCAGGCAGCTGAGTATGTCCCAGAGAAGGTGAAGAAA
  GCGGAAAAGAAATTAGAAGAGAATCCATATGACCTTGATGCTTGGAGCATTCTCATTCGA
  GAGGCACAGAATCAACCTATAGACAAAGCACGGAAGACTTATGAACGCCTTGTTGCCCAG
  TTCCCCAGTTCTGGCAGATTCTGGAAACTGTACATTGAAGCAGAGGTTACTATTTTATTT
  TATTTTTTCTTATATCAGTATTGCAGCATTCACTGTAGTGATAGAAAACAAGTTAGGAAC
  ATAGCCAATTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001033505
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001033505.1, NP_001028677.1
• RefSeq Size: 655 bp
• RefSeq ORF: 312 bp
• Locus ID: 1479
• Cytogenetics: 11p13
• Gene Summary: 'The protein encoded by this gene is one of three (including CSTF1 and CSTF2) cleavage stimulation factors that combine to form the cleavage stimulation factor complex (CSTF). This complex is involved in the polyadenylation and 3' end cleavage of pre-mRNAs. The encoded protein functions as a homodimer and interacts directly with both CSTF1 and CSTF2 in the CSTF complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) uses an alternate splice site in the 5' coding region, compared to variant 1. The encoded protein (isoform 2) is shorter and has a unique C-terminus, compared to isoform 1.