Archaemetzincin 2 (AMZ2) (NM_001033569) Human Untagged Clone

CAT#: SC302737

AMZ2 (untagged)-Human archaelysin family metallopeptidase 2 (AMZ2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: AMZ2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene SC302737 ORF sequence for NM_001033569, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAAATAATACGGCACTCCGAACAGACACTAAAAACAGCTCTCATCTCAAAGAACCCAGTGCTTGTAT
  CACAGTATGAGAAATTAAATGCTGGGGAACAACGTTTAATGAATGAAGCCTTCCAGCCAGCCAGTGATCT
  CTTTGGACCCATTACCTTGCATTCTCCATCAGATTGGATCACCTCCCACCCTGAGGCTCCCCAAGACTTT
  GAACAGTTCTTCAGTGATCCTTACAGAAAGACACCCTCTCCAAACAAACGCAGCATTTATATACAGTCCA
  TTGGCTCTCTAGGAAACACCAGAATTATCAGTGAAGAATATATTAAATGGCTCACGGGCTACTGTAAAGC
  ATATTTCTATGGCTTGAGAGTAAAACTCCTAGAACCAGTTCCTGTTTCTGTAACAAGATGTTCCTTTAGA
  GTCAATGAGAACACACACAACCTACAAATTCATGCAGGGGACATCCTGAAGTTCTTGAAAAAGAAGAAAC
  CTGAAGATGCCTTCTGTGTTGTGGGAATAACAATGATTGATCTTTACCCAAGAGACTCGTGGAATTTTGT
  CTTTGGACAGGCCTCTTTGACAGATGGTGTGGGGATATTCAGCTTTGCCAGGTATGGCAGTGATTTTTAT
  AGCATGCACTATAAAGGCAAAGTGAAGAAGCTCAAGAAAACATCTTCAAGTGACTATTCAATTTTCGACA
  ACTATTATATTCCAGAAATAACTAGTGTTTTACTACTTCGATCCTGTAAGACTTTAACCCATGAGATCGG
  ACACATATTTGGACTGCGACACTGCCAGTGGCTTGCATGCCTCATGCAAGGCTCCAACCACTTGGAAGAA
  GCTGACCGGCGCCCTCTAAACCTTTGCCCTATCTGTTTGCACAAGTTGCAGTGTGCTGTTGGCTTCAGCA
  TTGTAGAAAGATACAAAGCACTGGTGAGGTGGATTGATGATGAATCTTCTGACACACCTGGAGCAACTCC
  AGAACACAGTCACGAGGATAATGGGAATTTACCGAAACCCGTGGAAGCCTTTAAGGAATGGAAAGAGTGG
  ATAATAAAATGCCTGGCTGTTCTCCAAAAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001033569
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001033569.1, NP_001028741.1
• RefSeq Size: 1427 bp
• RefSeq ORF: 1083 bp
• Locus ID: 51321
• Cytogenetics: 17q24.2
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene is a zinc metalloprotease that displays some activity against angiotensin-3. The encoded protein is inhibited by the aminopeptidase inhibitor amastatin, as well as by the general inhibitors o-phenanthroline and batimastat. Defects in this gene may be associated with lung tumorigenesis. [provided by RefSeq, Oct 2016]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1-5 and 7-17 all encode the same isoform (1).