Archaemetzincin 2 (AMZ2) (NM_001033572) Human Untagged Clone
CAT#: SC302740
AMZ2 (untagged)-Human archaelysin family metallopeptidase 2 (AMZ2), transcript variant 5
"NM_001033572" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | AMZ2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001033572, the custom clone sequence may differ by one or more nucleotides
ATGCAAATAATACGGCACTCCGAACAGACACTAAAAACAGCTCTCATCTCAAAGAACCCA GTGCTTGTATCACAGTATGAGAAATTAAATGCTGGGGAACAACGTTTAATGAATGAAGCC TTCCAGCCAGCCAGTGATCTCTTTGGACCCATTACCTTGCATTCTCCATCAGATTGGATC ACCTCCCACCCTGAGGCTCCCCAAGACTTTGAACAGTTCTTCAGTGATCCTTACAGAAAG ACACCCTCTCCAAACAAACGCAGCATTTATATACAGTCCATTGGCTCTCTAGGAAACACC AGAATTATCAGTGAAGAATATATTAAATGGCTCACGGGCTACTGTAAAGCATATTTCTAT GGCTTGAGAGTAAAACTCCTAGAACCAGTTCCTGTTTCTGTAACAAGATGTTCCTTTAGA GTCAATGAGAACACACACAACCTACAAATTCATGCAGGGGACATCCTGAAGTTCTTGAAA AAGAAGAAACCTGAAGATGCCTTCTGTGTTGTGGGAATAACAATGATTGATCTTTACCCA AGAGACTCGTGGAATTTTGTCTTTGGACAGGCCTCTTTGACAGATGGTGTGGGGATATTC AGCTTTGCCAGGTATGGCAGTGATTTTTATAGCATGCACTATAAAGGCAAAGTGAAGAAG CTCAAGAAAACATCTTCAAGTGACTATTCAATTTTCGACAACTATTATATTCCAGAAATA ACTAGTGTTTTACTACTTCGATCCTGTAAGACTTTAACCCATGAGATCGGACACATATTT GGACTGCGACACTGCCAGTGGCTTGCATGCCTCATGCAAGGCTCCAACCACTTGGAAGAA GCTGACCGGCGCCCTCTAAACCTTTGCCCTATCTGTTTGCACAAGTTGCAGTGTGCTGTT GGCTTCAGCATTGTAGAAAGATACAAAGCACTGGTGAGGTGGATTGATGATGAATCTTCT GACACACCTGGAGCAACTCCAGAACACAGTCACGAGGATAATGGGAATTTACCGAAACCC GTGGAAGCCTTTAAGGAATGGAAAGAGTGGATAATAAAATGCCTGGCTGTTCTCCAAAAA TGA |
Restriction Sites | Please inquire |
ACCN | NM_001033572 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001033572.1, NP_001028744.1 |
RefSeq Size | 1395 bp |
RefSeq ORF | 1083 bp |
Locus ID | 51321 |
Cytogenetics | 17q24.2 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene is a zinc metalloprotease that displays some activity against angiotensin-3. The encoded protein is inhibited by the aminopeptidase inhibitor amastatin, as well as by the general inhibitors o-phenanthroline and batimastat. Defects in this gene may be associated with lung tumorigenesis. [provided by RefSeq, Oct 2016] Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Variants 1-5 and 7-17 all encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214585 | AMZ2 (Myc-DDK-tagged)-Human archaelysin family metallopeptidase 2 (AMZ2), transcript variant 5 |
USD 420.00 |
|
RG214585 | AMZ2 (GFP-tagged) - Human archaelysin family metallopeptidase 2 (AMZ2), transcript variant 5 |
USD 460.00 |
|
RC214585L3 | Lenti-ORF clone of AMZ2 (Myc-DDK-tagged)-Human archaelysin family metallopeptidase 2 (AMZ2), transcript variant 5 |
USD 620.00 |
|
RC214585L4 | Lenti-ORF clone of AMZ2 (mGFP-tagged)-Human archaelysin family metallopeptidase 2 (AMZ2), transcript variant 5 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review