PKC zeta (PRKCZ) (NM_001033581) Human Untagged Clone

CAT#: SC302748

PRKCZ (untagged)-Human protein kinase C, zeta (PRKCZ), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PRKCZ
• Synonyms: PKC-ZETA; PKC2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001033581, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATTCTGTCATGCCTTCCCAAGAGCCTCCAGTAGACGACAAGAACGAGGACGCCGACCTTCCTTCCG
  AGGAGACAGATGGAATTGCTTACATTTCCTCATCCCGGAAGCATGACAGCATTAAAGACGACTCGGAGGA
  CCTTAAGCCAGTTATCGATGGGATGGATGGAATCAAAATCTCTCAGGGGCTTGGGCTGCAGGACTTTGAC
  CTAATCAGAGTCATCGGGCGCGGGAGCTACGCCAAGGTTCTCCTGGTGCGGTTGAAGAAGAATGACCAAA
  TTTACGCCATGAAAGTGGTGAAGAAAGAGCTGGTGCATGATGACGAGGATATTGACTGGGTACAGACAGA
  GAAGCACGTGTTTGAGCAGGCATCCAGCAACCCCTTCCTGGTCGGATTACACTCCTGCTTCCAGACGACA
  AGTCGGTTGTTCCTGGTCATTGAGTACGTCAACGGCGGGGACCTGATGTTCCACATGCAGAGGCAGAGGA
  AGCTCCCTGAGGAGCACGCCAGGTTCTACGCGGCCGAGATCTGCATCGCCCTCAACTTCCTGCACGAGAG
  GGGGATCATCTACAGGGACCTGAAGCTGGACAACGTCCTCCTGGATGCGGACGGGCACATCAAGCTCACA
  GACTACGGCATGTGCAAGGAAGGCCTGGGCCCTGGTGACACAACGAGCACTTTCTGCGGAACCCCGAATT
  ACATCGCCCCCGAAATCCTGCGGGGAGAGGAGTACGGGTTCAGCGTGGACTGGTGGGCGCTGGGAGTCCT
  CATGTTTGAGATGATGGCCGGGCGCTCCCCGTTCGACATCATCACCGACAACCCGGACATGAACACAGAG
  GACTACCTTTTCCAAGTGATCCTGGAGAAGCCCATCCGGATCCCCCGGTTCCTGTCCGTCAAAGCCTCCC
  ATGTTTTAAAAGGATTTTTAAATAAGGACCCCAAAGAGAGGCTCGGCTGCCGGCCACAGACTGGATTTTC
  TGACATCAAGTCCCACGCGTTCTTCCGCAGCATAGACTGGGACTTGCTGGAGAAGAAGCAGGCGCTCCCT
  CCATTCCAGCCACAGATCACAGACGACTACGGTCTGGACAACTTTGACACACAGTTCACCAGCGAGCCCG
  TGCAGCTGACCCCAGACGATGAGGATGCCATAAAGAGGATCGACCAGTCAGAGTTCGAAGGCTTTGAGTA
  TATCAACCCATTATTGCTGTCCACCGAGGAGTCGGTGTGA
  
  
• Restriction Sites: SgfI-RsrII
• ACCN: NM_001033581
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001033581.1, NP_001028753.1
• RefSeq Size: 2147 bp
• RefSeq ORF: 1230 bp
• Locus ID: 5590
• Cytogenetics: 1p36.33
• Protein Families: Druggable Genome, Protein Kinase
• Protein Pathways: Chemokine signaling pathway, Endocytosis, Insulin signaling pathway, Tight junction, Type II diabetes mellitus
• Gene Summary: 'Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation from a downstream ATG and an isoform (2) with a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same isoform (2).