Calcitonin (CALCA) (NM_001033953) Human Untagged Clone

CAT#: SC302782

CALCA (untagged)-Human calcitonin-related polypeptide alpha (CALCA), transcript variant 3


  "NM_001033953" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CALCA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CALCA
Synonyms CALC1; CGRP; CGRP-alpha; CGRP-I; CGRP1; CT; KC; PCT
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001033953 edited
CGAGATTCTGGCTCAGAGAGGTGTCATGGGCTTCCAAAAGTTCTCCCCCTTCCTGGCTCT
CAGCATCTTGGTCCTGTTGCAGGCAGGCAGCCTCCATGCAGCACCATTCAGGTCTGCCCT
GGAGAGCAGCCCAGCAGACCCGGCCACGCTCAGTGAGGACGAAGCGCGCCTCCTGCTGGC
TGCACTGGTGCAGGACTATGTGCAGATGAAGGCCAGTGAGCTGGAGCAGGAGCAAGAGAG
AGAGGGCTCCAGAATCATTGCCCAGAAGAGAGCCTGTGACACTGCCACCTGTGTGACTCA
TCGGCTGGCAGGCTTGCTGAGCAGATCAGGGGGTGTGGTGAAGAACAACTTTGTGCCCAC
CAATGTGGGTTCCAAAGCCTTTGGCAGGCGCCGCAGGGACCTTCAAGCCTGAGCAGCTGA
ATGACTCAAGAAGGTCACAATAAAGCTGAACTCCTTTTAATGTGTAATGAAAGCAATTTG
TAGGAAAGGCTCCATGGAAGACA
>OriGene 5' read for NM_001033953 unedited
GGGACGTTAGATTTGTATACGACTCATATAGGCGGCCGCGNATTCGCCCTTCGANATTCT
GGCTCAGAGAGGTGTCATGGGCTTCCAAAGTTCTCCCCCTTCCTGGCTCTCAGCATCTTG
GTCCTGTTGCAGGCAGGCAGCCTCCATGCAGCACCATTCAGGTCTGCCCTGGAGAGCAGC
CCAGCAGACCCGGCCACGCTCAGTGAGGACGAAGCGCGCCTCCTGCTGGCTGCACTGGTG
CAGGACTATGTGCAGATGAAGGCCAGTGAGCTGGAGCAGGAGCAAGAGAGAGAGGGCTCC
AGAATCATTGCCCAGAAGAGAGCCTGTGACACTGCCACCTGTGTGACTCATCGGCTGGCA
GGCTTGCTGAGCAGATCAGGGGGTGTGGTGAAGAACAACTTTGTGCCCACCAATGTGGGT
TCCAAAGCCTTTGGCAGGCGCCGCAGGGACCTTCAAGCCTGAGCAGCTGAATGACTCAAG
AAGGTCACAATAAAGCTGAACTCCTTTTAATGTGTAATGAAAGCAATTTGTAGGAAAGGC
TCCATGGAAGACAAAGGGCGAATTCAGATCTGGTACCGATATCAAGCTTGTCGACTCTAG
ATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCC
TCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCNT
ATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATATATTATGGNGTGGA
GGGGGGTGGTATGGAGCAGGGGCAAGTTGGGAAGACACCTGTAGGGCCTGCNGGGTCTAT
TGGGAACCAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATC
Restriction Sites Please inquire     
ACCN NM_001033953
Insert Size 500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001033953.1, NP_001029125.1
RefSeq Size 915 bp
RefSeq ORF 387 bp
Locus ID 796
Cytogenetics 11p15.2
Protein Families Druggable Genome, Secreted Protein
Gene Summary 'This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2014]'
Transcript Variant: This variant (3) represents the longest coding transcript and encodes the shorter protein, which is cleaved to yield calcitonin gene-related peptide 1 (alpha-CGRP). Alpha-CGRP functions both as an antimicrobial peptide and a vasodilator. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.