SRA1 (NM_001035235) Human Untagged Clone

CAT#: SC302827

SRA1 (untagged)-Human steroid receptor RNA activator 1 (SRA1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SRA1
• Synonyms: pp7684; SRA; SRAP; STRAA1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001035235, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACGCGCTGCCCCGCTGGCCAAGCGGAAGTGGAGATGGCGGAGCTGTACGTGAAGCCGGGCAACAAGG
  AACGCGGCTGGAACGACCCGCCGCAGTTCTCATACGGGCTGCAGACCCAGGCCGGCGGACCCAGGCGCTC
  GCTGCTTACCAAGAGGGTCGCCGCACCCCAGGATGGATCCCCCAGAGTCCCCGCATCAGAGACTTCTCCT
  GGGCCTCCCCCAATGGGGCCTCCACCTCCTTCAAGTAAGGCTCCCAGGTCCCCACCTGTGGGGAGTGGTC
  CTGCCTCTGGCGTGGAGCCCACAAGTTTCCCAGTCGAGTCTGAGGCTGTGATGGAGGATGTGCTGAGACC
  TTTGGAACAGGCATTGGAAGACTGCCGTGGCCACACAAGGAAGCAGGTATGTGATGACATCAGCCGACGC
  CTGGCACTGCTGCAGGAACAGTGGGCTGGAGGAAAGTTGTCAATACCTGTAAAGAAGAGAATGGCTCTAC
  TGGTGCAAGAGCTTTCAAGCCACCGGTGGGACGCAGCAGATGACATCCACCGCTCCCTCATGGTTGACCA
  TGTGACTGAGGTCAGTCAGTGGATGGTAGGAGTTAAAAGATTAATTGCAGAAAAGAGGAGTCTGTTTTCA
  GAGGAGGCAGCCAATGAAGAGAAATCTGCAGCCACAGCTGAGAAGAACCATACCATACCAGGCTTCCAGC
  AGGCTTCATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001035235
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001035235.3, NP_001030312.2
• RefSeq Size: 1955 bp
• RefSeq ORF: 711 bp
• Locus ID: 10011
• Cytogenetics: 5q31.3
• Gene Summary: Both long non-coding and protein-coding RNAs are transcribed from this gene, and they represent alternatively spliced transcript variants. This gene was initially defined as a non-coding RNA, which is a coactivator for several nuclear receptors (NRs) and is associated with breast cancer. It has now been found that this gene is involved in the regulation of many NR and non-NR activities, including metabolism, adipogenesis and chromatin organization. The long non-coding RNA transcripts interact with a variety of proteins, including the protein encoded by this gene. The encoded protein acts as a transcriptional repressor by binding to the non-coding RNA. [provided by RefSeq, Mar 2012]
  Transcript Variant: This variant (1) encodes the longer isoform (1).