UFD1 (NM_001035247) Human Untagged Clone

CAT#: SC302828

UFD1L (untagged)-Human ubiquitin fusion degradation 1 like (yeast) (UFD1L), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UFD1
• Synonyms: UFD1L
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001035247, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTCTCTTTCAACATGTTCGACCACCCTATTCCCAGGGTCTTCCAAAACCGCTTCTCCACACAGTACC
  GCTGCTTCTCTGTGTCCATGCTAGCAGGGCCTAATGACAGGTCAGATGTGGAGAAAGGAGGGAAGATAAT
  TATGCCACCCTCGGCCCTGGACCAACTCAGCCGACTTAACATTACCTATCCCATGCTGTTCAAACTGACC
  AATAAGAATTCGGACCGCATGACGCATTGTGGCGTGCTGGAGTTTGTGGCTGATGAGGGCATCTGCTACC
  TCCCACACTGGATGATGCAGAACTTACTCTTGGAAGAAGGCGGCCTGGTCCAGGTGGAGAGCGTCAACCT
  TCAAGTGGCCACCTACTCCAAATTCCAACCTCAGAGCCCTGACTTCCTGGACATCACCAACCCCAAAGCC
  GTATTAGAAAACGCACTTAGGAACTTTGCCTGTCTGACCACCGGGGATGTGATTGCCATCAACTATAATG
  AAAAGATCTACGAACTGCGTGTGATGGAGACCAAACCCGACAAGGCAGTGTCCATCATTGAGTGTGACAT
  GAACGTGGACTTTGATGCTCCCCTGGGCTACAAAGAACCCGAAAGACAAGTCCAGCATGAGGAGTCGACA
  GAAGGTGAAGCCGACCACAGTGGCTATGCTGGAGAGCTGGGCTTCCGCGCTTTCTCTGGATCTGGCAATA
  GACTGGATGGAAAGAAGAAAGGGGTAGAGCCCAGCCCCTCCCCAATCAAGCCTGGAGATATTAAAAGAGG
  AATTCCCAATTATGAATTTAAACTTGGATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001035247
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001035247.2, NP_001030324.2
• RefSeq Size: 1730 bp
• RefSeq ORF: 801 bp
• Locus ID: 7353
• Cytogenetics: 22q11.21
• Gene Summary: 'The protein encoded by this gene forms a complex with two other proteins, nuclear protein localization-4 and valosin-containing protein, and this complex is necessary for the degradation of ubiquitinated proteins. In addition, this complex controls the disassembly of the mitotic spindle and the formation of a closed nuclear envelope after mitosis. Mutations in this gene have been associated with Catch 22 syndrome as well as cardiac and craniofacial defects. Alternative splicing results in multiple transcript variants encoding different isoforms. A related pseudogene has been identified on chromosome 18. [provided by RefSeq, Jun 2009]'
  Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region that results in a frameshift, compared to variant 1. The encoded isoform (B) has a distinct C-terminus and is shorter than isoform A.