ACTH (POMC) (NM_001035256) Human Untagged Clone
CAT#: SC302830
POMC (untagged)-Human proopiomelanocortin (POMC), transcript variant 1
"NM_001035256" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | POMC |
Synonyms | ACTH; CLIP; LPH; MSH; NPP; OBAIRH; POC |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001035256 edited
GCGTCCCCGCCCTCAGAGAGCAGCCTCCCGAGACAGGGGTCCCACCAATCTTGTTTGCTT CTGCAGAGCCTCAGCCTGCCTGGAAGATGCCGAGATCGTGCTGCAGCCGCTCGGGGGCCC TGTTGCTGGCCTTGCTGCTTCAGGCCTCCATGGAAGTGCGTGGCTGGTGCCTGGAGAGCA GCCAGTGTCAGGACCTCACCACGGAAAGCAACCTGCTGGAGTGCATCCGGGCCTGCAAGC CCGACCTCTCGGCCGAGACTCCCATGTTCCCGGGAAATGGCGACGAGCAGCCTCTGACCG AGAACCCCCGGAAGTACGTCATGGGCCACTTCCGCTGGGACCGATTCGGCCGCCGCAACA GCAGCAGCAGCGGCAGCAGCGGCGCAGGGCAGAAGCGCGAGGACGTCTCAGCGGGCGAAG ACTGCGGCCCGCTGCCTGAGGGCGGCCCCGAGCCCCGCAGCGATGGTGCCAAGCCGGGCC CGCGCGAGGGCAAGCGCTCCTACTCCATGGAGCACTTCCGCTGGGGCAAGCCGGTGGGCA AGAAGCGGCGCCCAGTGAAGGTGTACCCTAACGGCGCCGAGGACGAGTCGGCCGAGGCCT TCCCCCTGGAGTTCAAGAGGGAGCTGACTGGCCAGCGACTCCGGGAGGGAGATGGCCCCG ACGGCCCTGCCGATGACGGCGCAGGGGCCCAGGCCGACCTGGAGCACAGCCTGCTGGTGG CGGCCGAGAAGAAGGACGAGGGCCCCTACAGGATGGAGCACTTCCGCTGGGGCAGCCCGC CCAAGGACAAGCGCTACGGCGGTTTCATGACCTCCGAGAAGAGCCAGACGCCCCTGGTGA CGCTGTTCAAAAACGCCATCATCAAGAACGCCTACAAGAAGGGCGAGTGAGGGCACAGCG GGGCCCCAGGGCTACCCTCCCCCAGGAGGTCGACCCCAAAGCCCCTTGCTCTCCCCTGCC CTGCTGCCGCCTCCCAGCCTGGGGGGTCGTGGCAGATAATCAGCCTCTTAAAGCTGCCTG TAGTTAGGAAATAAAACCTTTCAAATTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001035256 |
Insert Size | 1100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001035256.1. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001035256.1, NP_001030333.1 |
RefSeq Size | 1295 bp |
RefSeq ORF | 804 bp |
Locus ID | 5443 |
Cytogenetics | 2p23.3 |
Protein Families | Druggable Genome |
Protein Pathways | Adipocytokine signaling pathway, Melanogenesis |
Gene Summary | 'This gene encodes a preproprotein that undergoes extensive, tissue-specific, post-translational processing via cleavage by subtilisin-like enzymes known as prohormone convertases. There are eight potential cleavage sites within the preproprotein and, depending on tissue type and the available convertases, processing may yield as many as ten biologically active peptides involved in diverse cellular functions. The encoded protein is synthesized mainly in corticotroph cells of the anterior pituitary where four cleavage sites are used; adrenocorticotrophin, essential for normal steroidogenesis and the maintenance of normal adrenal weight, and lipotropin beta are the major end products. In other tissues, including the hypothalamus, placenta, and epithelium, all cleavage sites may be used, giving rise to peptides with roles in pain and energy homeostasis, melanocyte stimulation, and immune modulation. These include several distinct melanotropins, lipotropins, and endorphins that are contained within the adrenocorticotrophin and beta-lipotropin peptides. The antimicrobial melanotropin alpha peptide exhibits antibacterial and antifungal activity. Mutations in this gene have been associated with early onset obesity, adrenal insufficiency, and red hair pigmentation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jan 2016]' Transcript Variant: This variant (1) differs in the 5' UTR compared to variant 3. Variants 1-4 encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215351 | POMC (Myc-DDK-tagged)-Human proopiomelanocortin (POMC), transcript variant 1 |
USD 420.00 |
|
RG215351 | POMC (GFP-tagged) - Human proopiomelanocortin (POMC), transcript variant 1 |
USD 460.00 |
|
RC215351L1 | Lenti ORF clone of Human proopiomelanocortin (POMC), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC215351L2 | Lenti ORF clone of Human proopiomelanocortin (POMC), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC215351L3 | Lenti ORF clone of Human proopiomelanocortin (POMC), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC215351L4 | Lenti ORF clone of Human proopiomelanocortin (POMC), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review