RPL41 (NM_001035267) Human Untagged Clone

CAT#: SC302833

RPL41 (untagged)-Human ribosomal protein L41 (RPL41), transcript variant 2


  "NM_001035267" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RPL41"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RPL41
Synonyms L41
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001035267, the custom clone sequence may differ by one or more nucleotides


ATGAGAGCCAAGTGGAGGAAGAAGCGAATGCGCAGGCTGAAGCGCAAAAGAAGAAAGATGAGGCAGAGGT
CCAAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001035267
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001035267.1, NP_001030344.1
RefSeq Size 593 bp
RefSeq ORF 78 bp
Locus ID 6171
Cytogenetics 12q13.2
Protein Pathways Ribosome
Gene Summary 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which shares sequence similarity with the yeast ribosomal protein YL41, belongs to the L41E family of ribosomal proteins. It is located in the cytoplasm. The protein can interact with the beta subunit of protein kinase CKII and can stimulate the phosphorylation of DNA topoisomerase II-alpha by CKII. Two alternative splice variants have been identified, both encoding the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (2) is the longer transcript, containing a unique segment in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.