SDHC (NM_001035513) Human Untagged Clone

CAT#: SC302839

SDHC (untagged)-Human succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa (SDHC), nuclear gene encoding mitochondrial protein, transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SDHC
• Synonyms: CYB560; CYBL; PGL3; QPS1; SDH3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001035513, the custom clone sequence may differ by one or more nucleotides
  ATGGCTGCGCTGTTGCTGAGTTGGTCTCTTCCCATGGCGATGTCCATCTGCCACCGTGGC
  ACTGGTATTGCTTTGAGTGCAGGGGTCTCTCTTTTTGGCATGTCGGCCCTGTTACTCCCT
  GGGAACTTTGAGTCTTATTTGGAACTTGTGAAGTCCCTGTGTCTGGGGCCAGCACTGATC
  CACACAGCTAAGTTTGCACTTGTCTTCCCTCTCATGTATCATACCTGGAATGGGATCCGA
  CACTTGATGTGGGACCTAGGAAAAGGCCTGAAGATTCCCCAGCTATACCAGTCTGGAGTG
  GTTGTCCTGGTTCTTACTGTGTTGTCCTCTATGGGGCTGGCAGCCATGTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001035513
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001035513.1, NP_001030590.1
• RefSeq Size: 2699 bp
• RefSeq ORF: 351 bp
• Locus ID: 6391
• Cytogenetics: 1q23.3
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Alzheimer's disease, Citrate cycle (TCA cycle), Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
• Gene Summary: 'This gene encodes one of four nuclear-encoded subunits that comprise succinate dehydrogenase, also known as mitochondrial complex II, a key enzyme complex of the tricarboxylic acid cycle and aerobic respiratory chains of mitochondria. The encoded protein is one of two integral membrane proteins that anchor other subunits of the complex, which form the catalytic core, to the inner mitochondrial membrane. There are several related pseudogenes for this gene on different chromosomes. Mutations in this gene have been associated with paragangliomas. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2013]'
  Transcript Variant: This variant (4, also known as delta2+3) lacks two alternate exons in the 5' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (4) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.