NrCAM (NM_001037133) Human Untagged Clone
CAT#: SC302852
NRCAM (untagged)-Human neuronal cell adhesion molecule (NRCAM), transcript variant 3
Product Images
Other products for "NRCAM"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NRCAM |
Synonyms | KIAA0343; MGC138845; MGC138846 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001037133 edited
GTCTGATGTGTGCTGTTGCTCTCCTTATCTTAATTTTGCTGATTGTTTGCTTCATCAGAA GAAACAAGGGTGGTAAATATCCAGTTAAAGAAAAGGAAGATGCCCATGCTGACCCTGAAA TCCAGCCTATGAAGGAAATGGAATTTTGTAGGTCTCTTGAAAGTGATGCAGAAGACCACA AGCCTTTGAAAAAAGGAAGTCGAACTCCTTCAGACAGGACTGTGAAAAAAGAAGATAGTG ACGACAGCCTAGTTGACTATGGAGAAGGGGTTAATGGCCAGTTCAATGAGGATGGCTCCT TTATTGGACAATACAGTGGTAAGAAAGAGAAAGAGCCGGCTGAAGGAAACGAAAGCTCAG AGGCACCTTCTCCTGTCAACGCCATGAATTCCTTTGTTTAATTTTTAAGCTCTTTGCCAA TATTCCATTTCTCTAGAATGTTTATCCTAAGCACTTGTTTGTCAGCCCTCTCATACTATG AACATATGGGTAGAGAGTATATTTTCTGCTGTATGTTAGTATTATGAGAATAGTTACAGC AAAAACATAACTCAGTCAAATGATATGTTAATATGAACTGGAATGCAAAGTGCATACTTT TTCATTCAAAATGGGTATTCTTGATTTCCTCAGAACTGATAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001037133 |
Insert Size | 650 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001037133.1, NP_001032210.1 |
RefSeq Size | 2821 bp |
RefSeq ORF | 264 bp |
Locus ID | 4897 |
Cytogenetics | 7q31.1 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cell adhesion molecules (CAMs) |
Gene Summary | 'Cell adhesion molecules (CAMs) are members of the immunoglobulin superfamily. This gene encodes a neuronal cell adhesion molecule with multiple immunoglobulin-like C2-type domains and fibronectin type-III domains. This ankyrin-binding protein is involved in neuron-neuron adhesion and promotes directional signaling during axonal cone growth. This gene is also expressed in non-neural tissues and may play a general role in cell-cell communication via signaling from its intracellular domain to the actin cytoskeleton during directional cell migration. Allelic variants of this gene have been associated with autism and addiction vulnerability. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (3) lacks multiple 5' exons and contains two alternate exons, compared to variant 1. These differences result in translation initiation from a downstream AUG and an isoform (C) which is shorter and has a distinct N-terminus, compared to isoform A. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.