GGPS1 (NM_001037277) Human Untagged Clone

CAT#: SC302871

GGPS1 (untagged)-Human geranylgeranyl diphosphate synthase 1 (GGPS1), transcript variant 2


  "NM_001037277" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GGPS1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GGPS1
Synonyms GGPPS; GGPPS1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001037277, the custom clone sequence may differ by one or more nucleotides


ATGGAGAAGACTCAAGAAACAGTCCAAAGAATTCTTCTAGAACCCTATAAATACTTACTTCAGTTACCAG
GTAAACAAGTGAGAACCAAACTTTCACAGGCATTTAATCATTGGCTGAAAGTTCCAGAGGACAAGCTACA
GATTATTATTGAAGTGACAGAAATGTTGCATAATGCCAGTTTACTCATCGATGATATTGAAGACAACTCA
AAACTCCGACGTGGCTTTCCAGTGGCCCACAGCATCTATGGAATCCCATCTGTCATCAATTCTGCCAATT
ACGTGTATTTCCTTGGCTTGGAGAAAGTCTTAACCCTTGATCACCCAGATGCAGTGAAGCTTTTTACCCG
CCAGCTTTTGGAACTCCATCAGGGACAAGGCCTAGATATTTACTGGAGGGATAATTACACTTGTCCCACT
GAAGAAGAATATAAAGCTATGGTGCTGCAGAAAACAGGTGGACTGTTTGGATTAGCAGTAGGTCTCATGC
AGTTGTTCTCTGATTACAAAGAAGATTTAAAACCGCTACTTAATACACTTGGGCTCTTTTTCCAAATTAG
GGATGATTATGCTAATCTACACTCCAAAGAATATAGTGAAAACAAAAGTTTTTGTGAAGATCTGACAGAG
GGAAAGTTCTCATTTCCTACTATTCATGCTATTTGGTCAAGGCCTGAAAGCACCCAGGTGCAGAATATCT
TGCGCCAGAGAACAGAAAACATAGATATAAAAAAATACTGTGTACATTATCTTGAGGATGTAGGTTCTTT
TGAATACACTCGTAATACCCTTAAAGAGCTTGAAGCTAAAGCCTATAAACAGATTGATGCACGTGGTGGG
AACCCTGAGCTAGTAGCCTTAGTAAAACACTTAAGTAAGATGTTCAAAGAAGAAAATGAATAA


Restriction Sites SgfI-MluI     
ACCN NM_001037277
ORF Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001037277.1, NP_001032354.1
RefSeq Size 2757
RefSeq ORF 903
Locus ID 9453
Protein Pathways Metabolic pathways, Terpenoid backbone biosynthesis
Gene Summary This gene is a member of the prenyltransferase family and encodes a protein with geranylgeranyl diphosphate (GGPP) synthase activity. The enzyme catalyzes the synthesis of GGPP from farnesyl diphosphate and isopentenyl diphosphate. GGPP is an important molecule responsible for the C20-prenylation of proteins and for the regulation of a nuclear hormone receptor. Alternate transcriptional splice variants, both protein-coding and non-protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]
Transcript Variant: This variant (2) encodes the functional protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.