GGPS1 (NM_001037277) Human Untagged Clone
CAT#: SC302871
GGPS1 (untagged)-Human geranylgeranyl diphosphate synthase 1 (GGPS1), transcript variant 2
"NM_001037277" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GGPS1 |
Synonyms | GGPPS; GGPPS1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001037277, the custom clone sequence may differ by one or more nucleotides
ATGGAGAAGACTCAAGAAACAGTCCAAAGAATTCTTCTAGAACCCTATAAATACTTACTTCAGTTACCAG GTAAACAAGTGAGAACCAAACTTTCACAGGCATTTAATCATTGGCTGAAAGTTCCAGAGGACAAGCTACA GATTATTATTGAAGTGACAGAAATGTTGCATAATGCCAGTTTACTCATCGATGATATTGAAGACAACTCA AAACTCCGACGTGGCTTTCCAGTGGCCCACAGCATCTATGGAATCCCATCTGTCATCAATTCTGCCAATT ACGTGTATTTCCTTGGCTTGGAGAAAGTCTTAACCCTTGATCACCCAGATGCAGTGAAGCTTTTTACCCG CCAGCTTTTGGAACTCCATCAGGGACAAGGCCTAGATATTTACTGGAGGGATAATTACACTTGTCCCACT GAAGAAGAATATAAAGCTATGGTGCTGCAGAAAACAGGTGGACTGTTTGGATTAGCAGTAGGTCTCATGC AGTTGTTCTCTGATTACAAAGAAGATTTAAAACCGCTACTTAATACACTTGGGCTCTTTTTCCAAATTAG GGATGATTATGCTAATCTACACTCCAAAGAATATAGTGAAAACAAAAGTTTTTGTGAAGATCTGACAGAG GGAAAGTTCTCATTTCCTACTATTCATGCTATTTGGTCAAGGCCTGAAAGCACCCAGGTGCAGAATATCT TGCGCCAGAGAACAGAAAACATAGATATAAAAAAATACTGTGTACATTATCTTGAGGATGTAGGTTCTTT TGAATACACTCGTAATACCCTTAAAGAGCTTGAAGCTAAAGCCTATAAACAGATTGATGCACGTGGTGGG AACCCTGAGCTAGTAGCCTTAGTAAAACACTTAAGTAAGATGTTCAAAGAAGAAAATGAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001037277 |
ORF Size | 903 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001037277.1, NP_001032354.1 |
RefSeq Size | 2757 |
RefSeq ORF | 903 |
Locus ID | 9453 |
Protein Pathways | Metabolic pathways, Terpenoid backbone biosynthesis |
Gene Summary | This gene is a member of the prenyltransferase family and encodes a protein with geranylgeranyl diphosphate (GGPP) synthase activity. The enzyme catalyzes the synthesis of GGPP from farnesyl diphosphate and isopentenyl diphosphate. GGPP is an important molecule responsible for the C20-prenylation of proteins and for the regulation of a nuclear hormone receptor. Alternate transcriptional splice variants, both protein-coding and non-protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010] Transcript Variant: This variant (2) encodes the functional protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215732 | GGPS1 (Myc-DDK-tagged)-Human geranylgeranyl diphosphate synthase 1 (GGPS1), transcript variant 2 |
USD 420.00 |
|
RG215732 | GGPS1 (GFP-tagged) - Human geranylgeranyl diphosphate synthase 1 (GGPS1), transcript variant 2 |
USD 460.00 |
|
RC215732L3 | Lenti ORF clone of Human geranylgeranyl diphosphate synthase 1 (GGPS1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC215732L4 | Lenti ORF clone of Human geranylgeranyl diphosphate synthase 1 (GGPS1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review