GGPS1 (NM_001037278) Human Untagged Clone

CAT#: SC302872

GGPS1 (untagged)-Human geranylgeranyl diphosphate synthase 1 (GGPS1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GGPS1
• Synonyms: GGPPS; GGPPS1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001037278, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTGCATAATGCCAGTTTACTCATCGATGATATTGAAGACAACTCAAAACTCCGACGTGGCTTTCCAG
  TGGCCCACAGCATCTATGGAATCCCATCTGTCATCAATTCTGCCAATTACGTGTATTTCCTTGGCTTGGA
  GAAAGTCTTAACCCTTGATCACCCAGATGCAGTGAAGCTTTTTACCCGCCAGCTTTTGGAACTCCATCAG
  GGACAAGGCCTAGATATTTACTGGAGGGATAATTACACTTGTCCCACTGAAGAAGAATATAAAGCTATGG
  TGCTGCAGAAAACAGGTGGACTGTTTGGATTAGCAGTAGGTCTCATGCAGTTGTTCTCTGATTACAAAGA
  AGATTTAAAACCGCTACTTAATACACTTGGGCTCTTTTTCCAAATTAGGGATGATTATGCTAATCTACAC
  TCCAAAGAATATAGTGAAAACAAAAGTTTTTGTGAAGATCTGACAGAGGGAAAGTTCTCATTTCCTACTA
  TTCATGCTATTTGGTCAAGGCCTGAAAGCACCCAGGTGCAGAATATCTTGCGCCAGAGAACAGAAAACAT
  AGATATAAAAAAATACTGTGTACATTATCTTGAGGATGTAGGTTCTTTTGAATACACTCGTAATACCCTT
  AAAGAGCTTGAAGCTAAAGCCTATAAACAGATTGATGCACGTGGTGGGAACCCTGAGCTAGTAGCCTTAG
  TAAAACACTTAAGTAAGATGTTCAAAGAAGAAAATGAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001037278
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001037278.1, NP_001032355.1
• RefSeq Size: 2828 bp
• RefSeq ORF: 741 bp
• Locus ID: 9453
• Cytogenetics: 1q42.3
• Protein Pathways: Metabolic pathways, Terpenoid backbone biosynthesis
• Gene Summary: This gene is a member of the prenyltransferase family and encodes a protein with geranylgeranyl diphosphate (GGPP) synthase activity. The enzyme catalyzes the synthesis of GGPP from farnesyl diphosphate and isopentenyl diphosphate. GGPP is an important molecule responsible for the C20-prenylation of proteins and for the regulation of a nuclear hormone receptor. Alternate transcriptional splice variants, both protein-coding and non-protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]
  Transcript Variant: This variant (3) lacks an exon in the coding region, which results in initiation of translation at a downstream AUG. The resulting protein (isoform B) has a shorter N-terminus than isoform A.