DEFB112 (NM_001037498) Human Untagged Clone

CAT#: SC302902

DEFB112 (untagged)-Human defensin, beta 112 (DEFB112)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DEFB112
• Synonyms: DEFB-12
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001037498, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAATTATTGACAACCATATGTAGACTGAAACTTGAAAAAATGTACTCAAAGACAAATACATCTTCCA
  CAATATTTGAAAAGGCCCGACATGGGACAGAGAAAATCAGCACAGCCAGAAGTGAAGGGCACCATATCAC
  CTTTAGTAGGTGGAAGTCATGTACAGCGATTGGAGGTCGATGTAAAAATCAATGTGATGATAGTGAATTT
  AGGATTTCATACTGTGCAAGACCTACAACTCATTGCTGCGTGACAGAATGTGACCCTACGGACCCAAATA
  ATTGGATCCCAAAGGACTCAGTAGGGACTCAAGAATGGTACCCTAAAGACTCACGTCATTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001037498
• ORF Size: 342 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001037498.1, NP_001032587.1
• RefSeq Size: 342
• RefSeq ORF: 342
• Locus ID: 245915
• Protein Families: Secreted Protein
• Gene Summary: Defensins form a family of antimicrobial and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. [provided by RefSeq, Oct 2014]