CTLA4 (NM_001037631) Human Untagged Clone

CAT#: SC302916

CTLA4 (untagged)-Human cytotoxic T-lymphocyte-associated protein 4 (CTLA4), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CTLA4
• Synonyms: ALPS5; CD; CD152; CELIAC3; CTLA-4; GRD4; GSE; IDDM12
• Vector: pCMV6-XL6
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001037631 edited
  GACCTGAACACCGCTCCCATAAAGCCATGGCTTGCCTTGGATTTCAGCGGCACAAGGCTC
  AGCTGAACCTGGCTACCAGGACCTGGCCCTGCACTCTCCTGTTTTTTCTTCTCTTCATCC
  CTGTCTTCTGCAAAGCAATGCACGTGGCCCAGCCTGCTGTGGTACTGGCCAGCAGCCGAG
  GCATCGCCAGCTTTGTGTGTGAGTATGCATCTCCAGGCAAAGCCACTGAGGTCCGGGTGA
  CAGTGCTTCGGCAGGCTGACAGCCAGGTGACTGAAGTCTGTGCGGCAACCTACATGATGG
  GGAATGAGTTGACCTTCCTAGATGATTCCATCTGCACGGGCACCTCCAGTGGAAATCAAG
  TGAACCTCACTATCCAAGGACTGAGGGCCATGGACACGGGACTCTACATCTGCAAGGTGG
  AGCTCATGTACCCACCGCCATACTACCTGGGCATAGGCAACGGAACCCAGATTTATGTAA
  TTGCTAAAGAAAAGAAGCCCTCTTACAACAGGGGTCTATGTGAAAATGCCCCCAACAGAG
  CCAGAATGTGAAAAGCAATTTCAGCCTTATTTTATTCCCATCAATTGAGAAACCATTATG
  AAGAAGAGAGTCCATATTTCAATTTCCAAGAGCTGAGG
  
• Restriction Sites: Please inquire
• ACCN: NM_001037631
• Insert Size: 750 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to the reference.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001037631.1, NP_001032720.1
• RefSeq Size: 1878 bp
• RefSeq ORF: 525 bp
• Locus ID: 1493
• Cytogenetics: 2q33.2
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Autoimmune thyroid disease, Cell adhesion molecules (CAMs), T cell receptor signaling pathway
• Gene Summary: 'This gene is a member of the immunoglobulin superfamily and encodes a protein which transmits an inhibitory signal to T cells. The protein contains a V domain, a transmembrane domain, and a cytoplasmic tail. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. The membrane-bound isoform functions as a homodimer interconnected by a disulfide bond, while the soluble isoform functions as a monomer. Mutations in this gene have been associated with insulin-dependent diabetes mellitus, Graves disease, Hashimoto thyroiditis, celiac disease, systemic lupus erythematosus, thyroid-associated orbitopathy, and other autoimmune diseases. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform CTLA-4delTM (also known as sCTLA4) is soluble and lacks the transmembrane domain, compared to isoform a. The exon skip represented in this variant is is based on human U90273.1, and is consistent with mouse U90270.1 and the data published in PMID:10831323 and PMID:10556814. CCDS Note: This CCDS representation is based on U90273.1 and on full-length RT-PCR evidence from PMIDs 10831323 and 10556814. This variant also has homology support from cow AF539438.1, mouse U90270.1 and rat U90271.1.