AGRP (NM_001138) Human Untagged Clone

CAT#: SC302977

AGRP (untagged)-Human agouti related protein homolog (mouse) (AGRP)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: AGRP
• Synonyms: AGRT; ART; ASIP2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001138, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGACCGCAGCGGTGCTGAGCTGTGCCCTGCTGCTGGCACTGCCTGCCACGCGAGGAGCCCAGATGG
  GCTTGGCCCCCATGGAGGGCATCAGAAGGCCTGACCAGGCCCTGCTCCCAGAGCTCCCAGGCCTGGGCCT
  GCGGGCCCCACTGAAGAAGACAACTGCAGAACAGGCAGAAGAGGATCTGTTGCAGGAGGCTCAGGCCTTG
  GCAGAGGTACTAGACCTGCAGGACCGCGAGCCCCGCTCCTCACGTCGCTGCGTAAGGCTGCATGAGTCCT
  GCCTGGGACAGCAGGTGCCTTGCTGTGACCCATGTGCCACGTGCTACTGCCGCTTCTTCAATGCCTTCTG
  CTACTGCCGCAAGCTGGGTACTGCCATGAATCCCTGCAGCCGCACCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001138
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001138.1, NP_001129.1
• RefSeq Size: 783 bp
• RefSeq ORF: 399 bp
• Locus ID: 181
• Cytogenetics: 16q22.1
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Adipocytokine signaling pathway
• Gene Summary: 'This gene encodes an antagonist of the melanocortin-3 and melanocortin-4 receptor. It appears to regulate hypothalamic control of feeding behavior via melanocortin receptor and/or intracellular calcium regulation, and thus plays a role in weight homeostasis. Mutations in this gene have been associated with late on-set obesity. [provided by RefSeq, Dec 2009]'
  Transcript Variant: Transcript variant 1 contains a noncoding 5' exon and is expressed only in brain.