Bcl x (BCL2L1) (NM_001191) Human Untagged Clone

CAT#: SC302986

BCL2L1 (untagged)-Human BCL2-like 1 (BCL2L1), nuclear gene encoding mitochondrial protein, transcript variant 2


  "NM_001191" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "BCL2L1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BCL2L1
Synonyms Bcl-X; BCL-XL/S; BCL2L; BCLX; PPP1R52
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001191 edited
ATGTCTCAGAGCAACCGGGAGCTGGTGGTTGACTTTCTCTCCTACAAGCTTTCCCAGAAA
GGATACAGCTGGAGTCAGTTTAGTGATGTGGAAGAGAACAGGACTGAGGCCCCAGAAGGG
ACTGAATCGGAGATGGAGACCCCCAGTGCCATCAATGGCAACCCATCCTGGCACCTGGCA
GACAGCCCCGCGGTGAATGGAGCCACTGGCCACAGCAGCAGTTTGGATGCCCGGGAGGTG
ATCCCCATGGCAGCAGTAAAGCAAGCGCTGAGGGAGGCAGGCGACGAGTTTGAACTGCGG
TACCGGCGGGCATTCAGTGACCTGACATCCCAGCTCCACATCACCCCAGGGACAGCATAT
CAGAGCTTTGAACAGGATACTTTTGTGGAACTCTATGGGAACAATGCAGCAGCCGAGAGC
CGAAAGGGCCAGGAACGCTTCAACCGCTGGTTCCTGACGGGCATGACTGTGGCCGGCGTG
GTTCTGCTGGGCTCACTCTTCAGTCGGAAATGA
>Forward primer walk for NM_001191 unedited
ACCACATGAGACCCAGCCGGATTAGTCTAAGCGACGCGGAAAAAAAGGACCGAGCCCCGA
AGGACCGAATCGGAGAGGAGACACCGTGCCCCAACGGCAACCCATCCCGGCACCTGGCAG
ACAGCCCCGCGGTGAACGGAGCCACCGGCCACAGCAGCAGTTTGGACGCCCGGGAGGCGA
CCCCCATGGCAGCAGTAAAGCAAGCGCTGAGGGAGGCAGGCGACGAGTTTGAACTGCGGT
ACCGGCGGGCATTCAGTGACCTGACATCCCAGCTCCACATCACCCCAGGGACAGCATATC
AGAGCTTTGAACAGGATACTTTTGTGGAACTCTATGGGAACAATGCAGCAGCCGAGAGCC
GAAAGGGCCAGGAACGCTTTCAACCGCTGGTTCCTGACGGGCATGACTGTGGCCGGCGTG
GTTCTGCTGGGCTCACTCTTCAGTCGGAAATGACCAGACACTGACCATCCACTCTACCCT
CCCACCCCCTTCTCTGCTCCACCACATCCTCCGTCCAGCCGCCATTGCCACCAGGAGAAC
CACTACATGCAGCCCATGCCCACCTGCCCATCACAGGGTTGGGCCCAGACTCTGGTCCCT
TGCAGCTAGTTTTCTAGAATTTATCACACTTCTGTGAGACCCCCACACCTCAGTTCCCTT
GGCCTCAGAATTCACAAAATTTCCACAAAATCTGTCCAAAGGAGGCTGGCAGGTATGGAA
GGGTTTGTGGCTGGGGGCAGGAGGGCCCTACCTGATTGGTGCAACCCTTACCCCTTAGCC
TCCCTGAAAATGTTTTTCTGCCAGGGAGCTTGAAAGTTTTCAGACCTCTTCCCAGAAAGG
AGACTAGATTGCCTTTGTTTGATGTTGTGCTCAGATGATCATTTTCTCACTCTCCACACT
AACCTGGGTTCCTTTCTTCATCCTACCCCCTA
Restriction Sites Please inquire     
ACCN NM_001191
Insert Size 3000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001191.2, NP_001182.1
RefSeq Size 2386 bp
RefSeq ORF 513 bp
Locus ID 598
Cytogenetics 20q11.21
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
Protein Pathways Amyotrophic lateral sclerosis (ALS), Apoptosis, Chronic myeloid leukemia, Jak-STAT signaling pathway, Pancreatic cancer, Pathways in cancer, Small cell lung cancer
Gene Summary 'The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The proteins encoded by this gene are located at the outer mitochondrial membrane, and have been shown to regulate outer mitochondrial membrane channel (VDAC) opening. VDAC regulates mitochondrial membrane potential, and thus controls the production of reactive oxygen species and release of cytochrome C by mitochondria, both of which are the potent inducers of cell apoptosis. Alternative splicing results in multiple transcript variants encoding two different isoforms. The longer isoform acts as an apoptotic inhibitor and the shorter isoform acts as an apoptotic activator. [provided by RefSeq, Dec 2015]'
Transcript Variant: This variant (2) uses an alternate in-frame splice site, in the central coding region, compared to variant 1. The encoded isoform (Bcl-X(S), also known as Bcl-xS) is shorter than isoform Bcl-X(L).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.