KLF9 (NM_001206) Human Untagged Clone

CAT#: SC302992

KLF9 (untagged)-Human Kruppel-like factor 9 (KLF9)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KLF9
• Synonyms: BTEB; BTEB1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001206, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCGCGGCCGCCTACATGGACTTCGTGGCTGCCCAGTGTCTGGTTTCCATTTCGAACCGCGCTGCGG
  TGCCGGAGCATGGGGTCGCTCCGGACGCCGAGCGGCTGCGACTACCTGAGCGCGAGGTGACCAAGGAGCA
  CGGTGACCCGGGGGACACCTGGAAGGATTACTGCACACTGGTCACCATCGCCAAGAGCTTGTTGGACCTG
  AACAAGTACCGACCCATCCAGACCCCCTCCGTGTGCAGCGACAGTCTGGAAAGTCCAGATGAGGATATGG
  GATCCGACAGCGACGTGACCACCGAATCTGGGTCGAGTCCTTCCCACAGCCCGGAGGAGAGACAGGATCC
  TGGCAGCGCGCCCAGCCCGCTCTCCCTCCTCCATCCTGGAGTGGCTGCGAAGGGGAAACACGCCTCCGAA
  AAGAGGCACAAGTGCCCCTACAGTGGCTGTGGGAAAGTCTATGGAAAATCCTCCCATCTCAAAGCCCATT
  ACAGAGTGCATACAGGTGAACGGCCCTTTCCCTGCACGTGGCCAGACTGCCTTAAAAAGTTCTCCCGCTC
  AGACGAGCTGACCCGCCACTACCGGACCCACACTGGGGAAAAGCAGTTCCGCTGTCCGCTGTGTGAGAAG
  CGCTTCATGAGGAGTGACCACCTCACAAAGCACGCCCGGCGGCACACCGAGTTCCACCCCAGCATGATCA
  AGCGATCGAAAAAGGCGCTGGCCAACGCTTTGTGA
  
  
• Restriction Sites: Please inquire
• ACCN: NM_001206
• ORF Size: 735 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001206.2, NP_001197.1
• RefSeq Size: 5208
• RefSeq ORF: 735
• Locus ID: 687
• Gene Summary: The protein encoded by this gene is a transcription factor that binds to GC box elements located in the promoter. Binding of the encoded protein to a single GC box inhibits mRNA expression while binding to tandemly repeated GC box elements activates transcription. [provided by RefSeq, Jul 2008]