SIGLEC6 (NM_001245) Human Untagged Clone

CAT#: SC302997

SIGLEC6 (untagged)-Human sialic acid binding Ig-like lectin 6 (SIGLEC6), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SIGLEC6
• Synonyms: CD33L; CD33L1; CD33L2; CD327; CDW327; OBBP1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001245, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGGGAGCCCAGGAAGCCTCCGCCTCAGAGATGCTACCGCTGCTGCTGCCCCTGCTGTGGGCAGGGG
  CCCTGGCTCAGGAGCGGAGATTCCAGCTGGAGGGGCCAGAGTCACTGACGGTGCAGGAGGGTCTGTGCGT
  CCTCGTACCCTGCAGATTGCCCACTACCCTTCCAGCCTCGTACTATGGTTATGGCTACTGGTTCCTGGAA
  GGGGCTGATGTTCCAGTGGCCACAAACGACCCAGACGAAGAAGTGCAGGAGGAGACCCGGGGCCGATTCC
  ACCTCCTCTGGGATCCCAGAAGGAAGAACTGCTCCCTGAGCATCAGAGATGCCCGGAGGAGGGACAATGC
  TGCATACTTCTTTCGGTTGAAGTCCAAATGGATGAAATACGGTTATACATCTTCCAAGCTCTCTGTGCGT
  GTGATGGCCCTGACCCACAGGCCCAACATCTCCATCCCAGGGACCCTGGAGTCTGGCCATCCCAGCAATC
  TGACCTGCTCTGTGCCCTGGGTCTGTGAGCAGGGGACGCCCCCCATCTTCTCCTGGATGTCAGCTGCCCC
  CACCTCCCTGGGCCCCAGGACCACCCAGTCCTCGGTGCTCACAATCACCCCACGGCCCCAGGACCACAGC
  ACCAACCTCACCTGTCAGGTGACGTTCCCTGGAGCCGGTGTGACCATGGAGAGAACCATCCAGCTCAATG
  TCTCCTATGCTCCACAGAAAGTGGCCATCAGCATCTTCCAAGGAAACAGCGCAGCCTTCAAAATCCTGCA
  AAACACCTCGTCCCTCCCTGTCCTGGAGGGCCAGGCTCTGCGGCTGCTCTGTGATGCTGACGGCAACCCC
  CCTGCACACCTGAGCTGGTTCCAGGGCTTCCCCGCCCTGAACGCCACCCCCATCTCCAATACCGGGGTCC
  TGGAGCTGCCTCAAGTAGGGTCTGCAGAAGAAGGAGATTTCACCTGCCGTGCTCAGCATCCTCTGGGCTC
  CCTGCAAATCTCTCTGAGTCTCTTTGTGCATTGGAAACCAGAAGGCAGGGCTGGTGGTGTCCTGGGAGCA
  GTCTGGGGAGCTAGCATCACAACCCTGGTTTTCCTCTGTGTTTGCTTCATCTTCAGAGTGAAGACTAGAA
  GGAAGAAAGCAGCCCAGCCAGTGCAAAACACGGATGATGTGAACCCCGTCATGGTCTCAGGCTCCAGGGG
  TCATCAGCACCAGTTCCAGACAGGCATAGTTTCAGACCACCCTGCTGAGGCTGGCCCCATCTCAGAAGAT
  GAGCAGGAGCTCCACTACGCTGTCCTACACTTCCACAAGGTGCAACCTCAGGAACCAAAGGTCACCGACA
  CTGAGTACTCAGAAATCAAGATACACAAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001245
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001245.6, NP_001236.4
• RefSeq Size: 3863 bp
• RefSeq ORF: 1362 bp
• Locus ID: 946
• Cytogenetics: 19q13.41
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Gene Summary: 'This gene encodes a member of the SIGLEC (sialic acid binding immunoglobulin-like lectin) family of proteins. The encoded transmembrane receptor binds sialyl-TN glycans and leptin. Placental expression of the encoded protein is upregulated in preeclampsia. [provided by RefSeq, Jul 2016]'
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.