GALR1 (NM_001480) Human Untagged Clone

CAT#: SC303029

GALR1 (untagged)-Human galanin receptor 1 (GALR1)


  "NM_001480" in other vectors (4)

Reconstitution Protocol

USD 600.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "GALR1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GALR1
Synonyms GALNR; GALNR1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001480 edited
ATGGAGCTGGCGGTCGGGAACCTCAGCGAGGGCAACGCGAGCTGGCCGGAGCCCCCCGCC
CCGGAGCCCGGGCCGCTGTTCGGCATCGGCGTGGAGAACTTCGTCACGCTGGTGGTGTTC
GGCCTGATCTTCGCGCTGGGCGTGCTGGGCAACAGCCTAGTGATCACCGTGCTGGCGCGC
AGCAAGCCGGGCAAGCCGCGGAGCACCACCAACCTGTTCATCCTCAACCTGAGCATCGCC
GACCTGGCCTACCTGCTCTTCTGCATCCCCTTCCAGGCCACCGTGTACGCGCTGCCCACC
TGGGTGCTGGGCGCCTTCATCTGCAAGTTCATCCACTACTTCTTCACCGTGTCCATGCTG
GTGAGCATCTTCACCCTGGCCGCGATGTCCGTGGACCGCTACGTGGCCATCGTGCACTCG
CGGCGCTCCTCCTCCCTCAGGGTGTCCCGCAACGCGCTGCTGGGCGTGGGCTGCATCTGG
GCGCTGTCCATTGCCATGGCCTCGCCCGTGGCCTACCACCAGGGCCTCTTCCACCCGCGC
GCCAGCAACCAGACCTTCTGCTGGGAGCAGTGGCCCGACCCTCGCCACAAGAAGGCCTAC
GTGGTGTGCACCTTCGTCTTCGGCTACCTGCTGCCGCTCCTGCTCATCTGCTTCTGCTAT
GCCAAGGTCCTTAATCACTTGCATAAAAAGTTGAAGAACATGTCAAAGAAGTCTGAAGCA
TCCAAGAAAAAGACTGCACAGACAGTTCTGGTGGTGGTTGTGGTGTTTGGAATCTCCTGG
CTGCCGCACCACATCATCCATCTCTGGGCTGAGTTTGGAGTTTTCCCGCTGACGCCGGCT
TCCTTCCTCTTCAGAATCACCGCCCACTGCCTGGCGTACAGCAATTCCTCCGTGAATCCT
ATCATTTATGCATTTCTCTCTGAAAATTTCAGGAAGGCCTATAAACAAGTGTTCAAGTGT
CACATTCGCAAAGATTCACACCTGAGTGATACTAAAGAAAATAAAAGTCGAATAGACACC
CCACCATCAACCAATTGTACTCATGTGTGA
Restriction Sites Please inquire     
ACCN NM_001480
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001480.2.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001480.2, NP_001471.1
RefSeq Size 3056 bp
RefSeq ORF 1050 bp
Locus ID 2587
Cytogenetics 18q23
Protein Families Druggable Genome, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary 'The neuropeptide galanin elicits a range of biological effects by interaction with specific G-protein-coupled receptors. Galanin receptors are seven-transmembrane proteins shown to activate a variety of intracellular second-messenger pathways. GALR1 inhibits adenylyl cyclase via a G protein of the Gi/Go family. GALR1 is widely expressed in the brain and spinal cord, as well as in peripheral sites such as the small intestine and heart. [provided by RefSeq, Jul 2008]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.