HSPB2 (NM_001541) Human Untagged Clone

CAT#: SC303043

HSPB2 (untagged)-Human heat shock 27kDa protein 2 (HSPB2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HSPB2
• Synonyms: Hs.78846; HSP27; LOH11CR1K; MKBP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001541, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCGGGCCGCTCAGTGCCACATGCCCACCCGGCCACCGCCGAGTACGAATTTGCCAACCCGAGCCGCC
  TGGGTGAGCAGCGCTTCGGAGAAGGCCTCCTGCCAGAAGAGATCCTGACCCCCACACTCTACCATGGCTA
  CTATGTCCGGCCTCGGGCCGCCCCAGCTGGGGAGGGCAGCAGGGCAGGGGCCTCCGAGCTTAGGCTCAGT
  GAGGGCAAGTTCCAGGCATTTCTGGATGTGAGCCACTTTACCCCAGACGAGGTGACTGTGAGGACTGTGG
  ATAACCTGCTGGAGGTGTCTGCCCGGCACCCCCAGCGCCTGGACCGCCACGGCTTCGTGTCCCGAGAGTT
  CTGCCGCACCTATGTCCTGCCTGCTGATGTCGACCCCTGGCGAGTCCGAGCTGCTCTCTCCCATGATGGC
  ATCTTAAACCTGGAAGCACCTCGGGGTGGCCGACATTTGGACACAGAGGTCAATGAGGTCTACATCTCCC
  TGCTCCCTGCGCCTCCTGATCCAGAGGAAGAGGAGGAGGCAGCCATAGTTGAGCCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001541
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001541.3, NP_001532.1
• RefSeq Size: 858 bp
• RefSeq ORF: 549 bp
• Locus ID: 3316
• Cytogenetics: 11q23.1
• Gene Summary: 'The protein encoded by this gene belongs to the superfamily of small heat-shock proteins containing a conservative alpha-crystallin domain at the C-terminal part of the molecule. The protein is expressed preferentially in the heart and skeletal muscle. This protein regulates Myotonic Dystrophy Protein Kinase, which plays an important role in maintenance of muscle structure and function. [provided by RefSeq, Dec 2012]'