CD1 (CD1A) (NM_001763) Human Untagged Clone

CAT#: SC303065

CD1A (untagged)-Human CD1a molecule (CD1A)


  "NM_001763" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CD1A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CD1A
Synonyms CD1; FCB6; HTA1; R4; T6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001763, the custom clone sequence may differ by one or more nucleotides


ATGCTGTTTTTGCTACTTCCATTGTTAGCTGTTCTCCCAGGTGATGGCAATGCAGACGGGCTCAAGGAGC
CTCTCTCCTTCCATGTCACCTGGATCGCATCCTTTTACAACCATTCCTGGAAACAAAATCTGGTCTCAGG
TTGGCTGAGTGATTTGCAGACTCATACCTGGGACAGCAATTCCAGCACCATCGTTTTCCTGTGCCCCTGG
TCCAGGGGAAACTTCAGCAATGAGGAGTGGAAGGAACTGGAAACATTATTCCGTATACGCACCATTCGGT
CATTTGAGGGAATTCGTAGATACGCCCATGAATTGCAGTTTGAATATCCTTTTGAGATACAGGTGACAGG
AGGCTGTGAGCTGCACTCTGGAAAGGTCTCAGGAAGCTTCTTGCAGTTAGCTTATCAAGGATCAGACTTT
GTGAGCTTCCAGAACAATTCATGGTTGCCATATCCAGTGGCTGGGAATATGGCCAAGCATTTCTGCAAAG
TGCTCAATCAGAATCAGCATGAAAATGACATAACACACAATCTTCTCAGTGACACCTGCCCACGTTTCAT
CTTGGGTCTTCTTGATGCAGGAAAGGCACATCTCCAGCGGCAAGTGAAGCCCGAGGCCTGGCTGTCCCAT
GGCCCCAGTCCTGGCCCTGGCCATCTGCAGCTTGTGTGCCATGTCTCAGGATTCTACCCAAAGCCCGTGT
GGGTGATGTGGATGCGGGGTGAGCAGGAGCAGCAGGGCACTCAGCGAGGGGACATCTTGCCCAGTGCTGA
TGGGACATGGTATCTCCGCGCAACCCTGGAGGTGGCCGCTGGGGAGGCAGCTGACCTGTCCTGTCGGGTG
AAGCACAGCAGTCTAGAGGGCCAGGACATCGTCCTCTACTGGGAGCATCACAGTTCCGTGGGCTTCATCA
TCTTGGCGGTGATAGTGCCTTTACTTCTTCTGATAGGTCTTGCGCTTTGGTTCAGGAAACGCTGTTTCTG
TTAA


Restriction Sites SgfI-MluI     
ACCN NM_001763
ORF Size 984 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001763.2, NP_001754.2
RefSeq Size 2111
RefSeq ORF 984
Locus ID 909
Protein Families Druggable Genome, Transmembrane
Protein Pathways Hematopoietic cell lineage
Gene Summary This gene encodes a member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to the plasma membrane and to recycling vesicles of the early endocytic system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Transcript Variant: This variant (1) encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.