CD1B (NM_001764) Human Untagged Clone

CAT#: SC303066

CD1B (untagged)-Human CD1b molecule (CD1B)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD1B
• Synonyms: CD1; CD1A; R1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene SC303066 ORF sequence for NM_001764, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGCTGCTGCCATTTCAACTGTTAGCTGTTCTCTTTCCTGGTGGTAACAGTGAACATGCCTTCCAGG
  GGCCGACCTCCTTTCATGTTATCCAGACCTCGTCCTTTACCAATAGTACCTGGGCACAAACTCAAGGCTC
  AGGCTGGTTGGATGATTTGCAGATTCATGGCTGGGATAGCGACTCAGGCACTGCCATATTCCTGAAGCCT
  TGGTCTAAAGGTAACTTTAGTGATAAGGAGGTTGCTGAGTTAGAGGAGATATTCCGAGTCTACATCTTTG
  GATTCGCTCGAGAAGTACAAGACTTTGCCGGTGATTTCCAGATGAAATACCCCTTTGAGATCCAGGGCAT
  AGCAGGCTGTGAGCTACATTCTGGAGGTGCCATAGTAAGCTTCCTGAGGGGAGCTCTAGGAGGATTGGAT
  TTCCTGAGTGTCAAGAATGCTTCATGTGTGCCTTCCCCAGAAGGTGGCAGCAGGGCACAGAAATTCTGTG
  CACTAATCATACAATATCAAGGTATCATGGAAACTGTGAGAATTCTCCTCTATGAAACCTGCCCCCGATA
  TCTCTTGGGCGTCCTCAATGCAGGAAAAGCAGATCTGCAAAGACAAGTGAAGCCTGAGGCCTGGCTGTCC
  AGTGGCCCCAGTCCTGGACCTGGCCGTCTGCAGCTTGTGTGCCATGTCTCAGGATTCTACCCAAAGCCCG
  TGTGGGTGATGTGGATGCGGGGTGAGCAGGAGCAGCAGGGCACTCAGCTAGGGGACATCCTGCCCAATGC
  TAACTGGACATGGTATCTCCGAGCAACCCTGGATGTGGCAGATGGGGAGGCGGCTGGCCTGTCCTGTCGG
  GTGAAGCACAGCAGTTTAGAGGGCCAGGACATCATCCTCTACTGGAGAAACCCCACCTCCATTGGCTCAA
  TTGTTTTGGCAATAATAGTGCCTTCCTTGCTCCTTTTGCTATGCCTTGCATTATGGTATATGAGGCGCCG
  GTCATATCAGAATATCCCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001764
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001764.1, NP_001755.1
• RefSeq Size: 1396 bp
• RefSeq ORF: 1002 bp
• Locus ID: 910
• Cytogenetics: 1q23.1
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Hematopoietic cell lineage
• Gene Summary: 'This gene encodes a member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail, and requires vesicular acidification to bind lipid antigens. [provided by RefSeq, Jul 2008]'