IFNA14 (NM_002172) Human Untagged Clone

CAT#: SC303135

IFNA14 (untagged)-Human interferon, alpha 14 (IFNA14)


  "NM_002172" in other vectors (6)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "IFNA14"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IFNA14
Synonyms IFN-alphaH; LEIF2H
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_002172, the custom clone sequence may differ by one or more nucleotides


ATGGCATTGCCCTTTGCTTTAATGATGGCCCTGGTGGTGCTCAGCTGCAAGTCAAGCTGCTCTCTGGGCT
GTAATCTGTCTCAAACCCACAGCCTGAATAACAGGAGGACTTTGATGCTCATGGCACAAATGAGGAGAAT
CTCTCCTTTCTCCTGCCTGAAGGACAGACATGACTTTGAATTTCCCCAGGAGGAATTTGATGGCAACCAG
TTCCAGAAAGCTCAAGCCATCTCTGTCCTCCATGAGATGATGCAGCAGACCTTCAATCTCTTCAGCACAA
AGAACTCATCTGCTGCTTGGGATGAGACCCTCCTAGAAAAATTCTACATTGAACTTTTCCAGCAAATGAA
TGACCTGGAAGCCTGTGTGATACAGGAGGTTGGGGTGGAAGAGACTCCCCTGATGAATGAGGACTCCATC
CTGGCTGTGAAGAAATACTTCCAAAGAATCACTCTTTATCTGATGGAGAAGAAATACAGCCCTTGTGCCT
GGGAGGTTGTCAGAGCAGAAATCATGAGATCCCTCTCTTTTTCAACAAACTTGCAAAAAAGATTAAGGAG
GAAGGATTGA


Restriction Sites SgfI-MluI     
ACCN NM_002172
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002172.2, NP_002163.2
RefSeq Size 778 bp
RefSeq ORF 570 bp
Locus ID 3448
Cytogenetics 9p21.3
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Antigen processing and presentation, Autoimmune thyroid disease, Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, Regulation of autophagy, RIG-I-like receptor signaling pathway, Toll-like receptor signaling pathway
Gene Summary ''

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.