CD161 (KLRB1) (NM_002258) Human Untagged Clone

CAT#: SC303157

KLRB1 (untagged)-Human killer cell lectin-like receptor subfamily B, member 1 (KLRB1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KLRB1
• Synonyms: CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1; NKR-P1A; NKRP1A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_002258, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACCAACAAGCAATATATGCTGAGTTAAACTTACCCACAGACTCAGGCCCAGAAAGTTCTTCACCTT
  CATCTCTTCCTCGGGATGTCTGTCAGGGTTCACCTTGGCATCAATTTGCCCTGAAACTTAGCTGTGCTGG
  GATTATTCTCCTTGTCTTGGTTGTTACTGGGTTGAGTGTTTCAGTGACATCCTTAATACAGAAATCATCA
  ATAGAAAAATGCAGTGTGGACATTCAACAGAGCAGGAATAAAACAACAGAGAGACCGGGTCTCTTAAACT
  GCCCAATATATTGGCAGCAACTCCGAGAGAAATGCTTGTTATTTTCTCACACTGTCAACCCTTGGAATAA
  CAGTCTAGCTGATTGTTCCACCAAAGAATCCAGCCTGCTGCTTATTCGAGATAAGGATGAATTGATACAC
  ACACAGAACCTGATACGTGACAAAGCAATTCTGTTTTGGATTGGATTAAATTTTTCATTATCAGAAAAGA
  ACTGGAAGTGGATAAACGGCTCTTTTTTAAATTCTAATGACTTAGAAATTAGAGGTGATGCTAAAGAAAA
  CAGCTGTATTTCCATCTCACAGACATCTGTGTATTCTGAGTACTGTAGTACAGAAATCAGATGGATCTGC
  CAAAAAGAACTAACACCTGTGAGAAATAAAGTGTATCCTGACTCTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_002258
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002258.2, NP_002249.1
• RefSeq Size: 740 bp
• RefSeq ORF: 678 bp
• Locus ID: 3820
• Cytogenetics: 12p13.31
• Protein Families: Transmembrane
• Gene Summary: 'Natural killer (NK) cells are lymphocytes that mediate cytotoxicity and secrete cytokines after immune stimulation. Several genes of the C-type lectin superfamily, including the rodent NKRP1 family of glycoproteins, are expressed by NK cells and may be involved in the regulation of NK cell function. The KLRB1 protein contains an extracellular domain with several motifs characteristic of C-type lectins, a transmembrane domain, and a cytoplasmic domain. The KLRB1 protein is classified as a type II membrane protein because it has an external C terminus. [provided by RefSeq, Jul 2008]'