NKG2A (KLRC1) (NM_002259) Human Untagged Clone

CAT#: SC303158

KLRC1 (untagged)-Human killer cell lectin-like receptor subfamily C, member 1 (KLRC1), transcript variant 1


  "NM_002259" in other vectors (7)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KLRC1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KLRC1
Synonyms CD159A; NKG2; NKG2A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_002259, the custom clone sequence may differ by one or more nucleotides


ATGGATAACCAAGGAGTAATCTACTCAGACCTGAATCTGCCCCCAAACCCAAAGAGGCAGCAACGAAAAC
CTAAAGGCAATAAAAGCTCCATTTTAGCAACTGAACAGGAAATAACCTATGCGGAATTAAACCTTCAAAA
AGCTTCTCAGGATTTTCAAGGGAATGACAAAACCTATCACTGCAAAGATTTACCATCAGCTCCAGAGAAG
CTCATTGTTGGGATCCTGGGAATTATCTGTCTTATCTTAATGGCCTCTGTGGTAACGATAGTTGTTATTC
CCTCTACATTAATACAGAGGCACAACAATTCTTCCCTGAATACAAGAACTCAGAAAGCACGTCATTGTGG
CCATTGTCCTGAGGAGTGGATTACATATTCCAACAGTTGTTACTACATTGGTAAGGAAAGAAGAACTTGG
GAAGAGAGTTTGCTGGCCTGTACTTCGAAGAACTCCAGTCTGCTTTCTATAGATAATGAAGAAGAAATGA
AATTTCTGTCCATCATTTCACCATCCTCATGGATTGGTGTGTTTCGTAACAGCAGTCATCATCCATGGGT
GACAATGAATGGTTTGGCTTTCAAACATGAGATAAAAGACTCAGATAATGCTGAACTTAACTGTGCAGTG
CTACAAGTAAATCGACTTAAATCAGCCCAGTGTGGATCTTCAATAATATATCATTGTAAGCATAAGCTTT
AG


Restriction Sites SgfI-MluI     
ACCN NM_002259
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002259.4, NP_002250.1
RefSeq Size 1443 bp
RefSeq ORF 702 bp
Locus ID 3821
Cytogenetics 12p13.2
Protein Families Transmembrane
Protein Pathways Antigen processing and presentation, Graft-versus-host disease, Natural killer cell mediated cytotoxicity
Gene Summary 'Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. The protein encoded by this gene belongs to the killer cell lectin-like receptor family, also called NKG2 family, which is a group of transmembrane proteins preferentially expressed in NK cells. This family of proteins is characterized by the type II membrane orientation and the presence of a C-type lectin domain. This protein forms a complex with another family member, KLRD1/CD94, and has been implicated in the recognition of the MHC class I HLA-E molecules in NK cells. The genes of NKG2 family members form a killer cell lectin-like receptor gene cluster on chromosome 12. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jan 2015]'
Transcript Variant: This variant (1) encodes the longer isoform (NKG2-A). Variants 1 and 3 encode the same isoform (NKG2-A).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.