NKG2A (KLRC1) (NM_002259) Human Untagged Clone

CAT#: SC303158

KLRC1 (untagged)-Human killer cell lectin-like receptor subfamily C, member 1 (KLRC1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KLRC1
• Synonyms: CD159A; NKG2; NKG2A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_002259, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATAACCAAGGAGTAATCTACTCAGACCTGAATCTGCCCCCAAACCCAAAGAGGCAGCAACGAAAAC
  CTAAAGGCAATAAAAGCTCCATTTTAGCAACTGAACAGGAAATAACCTATGCGGAATTAAACCTTCAAAA
  AGCTTCTCAGGATTTTCAAGGGAATGACAAAACCTATCACTGCAAAGATTTACCATCAGCTCCAGAGAAG
  CTCATTGTTGGGATCCTGGGAATTATCTGTCTTATCTTAATGGCCTCTGTGGTAACGATAGTTGTTATTC
  CCTCTACATTAATACAGAGGCACAACAATTCTTCCCTGAATACAAGAACTCAGAAAGCACGTCATTGTGG
  CCATTGTCCTGAGGAGTGGATTACATATTCCAACAGTTGTTACTACATTGGTAAGGAAAGAAGAACTTGG
  GAAGAGAGTTTGCTGGCCTGTACTTCGAAGAACTCCAGTCTGCTTTCTATAGATAATGAAGAAGAAATGA
  AATTTCTGTCCATCATTTCACCATCCTCATGGATTGGTGTGTTTCGTAACAGCAGTCATCATCCATGGGT
  GACAATGAATGGTTTGGCTTTCAAACATGAGATAAAAGACTCAGATAATGCTGAACTTAACTGTGCAGTG
  CTACAAGTAAATCGACTTAAATCAGCCCAGTGTGGATCTTCAATAATATATCATTGTAAGCATAAGCTTT
  AG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_002259
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002259.4, NP_002250.1
• RefSeq Size: 1443 bp
• RefSeq ORF: 702 bp
• Locus ID: 3821
• Cytogenetics: 12p13.2
• Protein Families: Transmembrane
• Protein Pathways: Antigen processing and presentation, Graft-versus-host disease, Natural killer cell mediated cytotoxicity
• Gene Summary: 'Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. The protein encoded by this gene belongs to the killer cell lectin-like receptor family, also called NKG2 family, which is a group of transmembrane proteins preferentially expressed in NK cells. This family of proteins is characterized by the type II membrane orientation and the presence of a C-type lectin domain. This protein forms a complex with another family member, KLRD1/CD94, and has been implicated in the recognition of the MHC class I HLA-E molecules in NK cells. The genes of NKG2 family members form a killer cell lectin-like receptor gene cluster on chromosome 12. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jan 2015]'
  Transcript Variant: This variant (1) encodes the longer isoform (NKG2-A). Variants 1 and 3 encode the same isoform (NKG2-A).