NKG2C (KLRC2) (NM_002260) Human Untagged Clone

CAT#: SC303159

KLRC2 (untagged)-Human killer cell lectin-like receptor subfamily C, member 2 (KLRC2)


  "NM_002260" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "KLRC2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KLRC2
Synonyms CD159c; NKG2-C; NKG2C
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_002260 edited
GAGATGAATAAACAAAGAGGAACCTTCTCAGAAGTGAGTCTGGCCCAGGACCCAAAGCGG
CAGCAAAGGAAACCTAAAGGCAATAAAAGCTCCATTTCAGGAACCGAACAGGAAATATTC
CAAGTAGAATTAAATCTTCAAAATCCTTCCCTGAATCATCAAGGGATTGATAAAATATAT
GACTGCCAAGGTTTACTGCCACCTCCAGAGAAGCTCACTGCCGAGGTCCTAGGAATCATT
TGCATTGTCCTGATGGCCACTGTGTTAAAAACAATAGTTCTTATTCCTTTCCTGGAGCAG
AACAATTCTTCCCCGAATACAAGAACGCAGAAAGCACGTCATTGTGGCCATTGTCCTGAG
GAGTGGATTACATATTCCAACAGTTGTTATTACATTGGTAAGGAAAGAAGAACTTGGGAA
GAGAGTTTGCTGGCCTGTACTTCGAAGAACTCCAGTCTGCTTTCTATAGATAATGAAGAA
GAAATGAAATTTCTGGCCAGCATTTTACCTTCCTCATGGATTGGTGTGTTTCGTAACAGC
AGTCATCATCCATGGGTGACAATAAATGGTTTGGCTTTCAAACATAAGATAAAAGACTCA
GATAATGCTGAACTTAACTGTGCAGTGCTACAAGTAAATCGACTTAAATCAGCCCAGTGT
GGATCTTCAATGATATATCATTGTAAGCATAAGCTTTAG
Restriction Sites Please inquire     
ACCN NM_002260
Insert Size 700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002260.3.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002260.3, NP_002251.2
RefSeq Size 1223 bp
RefSeq ORF 696 bp
Locus ID 3822
Cytogenetics 12p13.2
Protein Families Transmembrane
Protein Pathways Antigen processing and presentation, Natural killer cell mediated cytotoxicity
Gene Summary 'Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. The group, designated KLRC (NKG2) are expressed primarily in natural killer (NK) cells and encodes a family of transmembrane proteins characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The KLRC (NKG2) gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed on NK cells. KLRC2 alternative splice variants have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.