Neurotrophin 3 (NTF3) (NM_002527) Human Untagged Clone
CAT#: SC303212
NTF3 (untagged)-Human neurotrophin 3 (NTF3), transcript variant 2
"NM_002527" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | NTF3 |
| Synonyms | HDNF; NGF-2; NGF2; NT-3; NT3 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_002527 edited
TGCCAGAATAACACAGACTCAGCTGCCAGAGCCTGCTCTTAACACCTGTGTTTCCTTTTC AGATCTTACAGGTGAACAAGGTGATGTCCATCTTGTTTTATGTGATATTTCTCGCTTATC TCCGTGGCATCCAAGGTAACAACATGGATCAAAGGAGTTTGCCAGAAGACTCGCTCAATT CCCTCATTATTAAGCTGATCCAGGCAGATATTTTGAAAAACAAGCTCTCCAAGCAGATGG TGGACGTTAAGGAAAATTACCAGAGCACCCTGCCCAAAGCTGAGGCTCCCCGAGAGCCGG AGCGGGGAGGGCCCGCCAAGTCAGCATTCCAGCCGGTGATTGCAATGGACACCGAACTGC TGCGACAACAGAGACGCTACAACTCACCGCGGGTCCTGCTGAGCGACAGCACCCCCTTGG AGCCCCCGCCCTTGTATCTCATGGAGGATTACGTGGGCAGCCCCGTGGTGGCGAACAGAA CATCACGGCGGAAACGGTACGCGGAGCATAAGAGTCACCGAGGGGAGTACTCGGTATGTG ACAGTGAGAGTCTGTGGGTGACCGACAAGTCATCGGCCATCGACATTCGGGGACACCAGG TCACGGTGCTGGGGGAGATCAAAACGGGCAACTCTCCCGTCAAACAATATTTTTATGAAA CGCGATGTAAGGAAGCCAGGCCGGTCAAAAACGGTTGCAGGGGTATTGATGATAAACACT GGAACTCTCAGTGCAAAACATCCCAAACCTACGTCCGAGCACTGACTTCAGAGAACAATA AACTCGTGGGCTGGCGGTGGATACGGATAGACACGTCCTGTGTGTGTGCCTTGTCGAGAA AAATCGGAAGAACATGAATTGGCATCTCTCCCCATATATAAATTATTACTTTAAATTATA TGATATGCATGTAGCATATAAATGTTTATATTGTTTTTATATATTATAAGTTGACCTTTA TTTATTAAACTTCAGCAACCCTACAGTATATAAGCTTTTTTCTCAATAAAATCAGTGTGC TTGCCTTC |
| Restriction Sites | Please inquire |
| ACCN | NM_002527 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002527.3. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_002527.3, NP_002518.1 |
| RefSeq Size | 1204 bp |
| RefSeq ORF | 774 bp |
| Locus ID | 4908 |
| Cytogenetics | 12p13.31 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | MAPK signaling pathway, Neurotrophin signaling pathway |
| Gene Summary | 'The protein encoded by this gene is a member of the neurotrophin family, that controls survival and differentiation of mammalian neurons. This protein is closely related to both nerve growth factor and brain-derived neurotrophic factor. It may be involved in the maintenance of the adult nervous system, and may affect development of neurons in the embryo when it is expressed in human placenta. NTF3-deficient mice generated by gene targeting display severe movement defects of the limbs. The mature peptide of this protein is identical in all mammals examined including human, pig, rat and mouse. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (2) has an alternate 5' sequence and uses a downstream AUG start codon, as compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214226 | NTF3 (Myc-DDK-tagged)-Human neurotrophin 3 (NTF3), transcript variant 2 |
USD 300.00 |
|
| RG214226 | NTF3 (GFP-tagged) - Human neurotrophin 3 (NTF3), transcript variant 2 |
USD 460.00 |
|
| RC214226L1 | Lenti ORF clone of Human neurotrophin 3 (NTF3), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
| RC214226L2 | Lenti ORF clone of Human neurotrophin 3 (NTF3), transcript variant 2, mGFP tagged |
USD 620.00 |
|
| RC214226L3 | Lenti ORF clone of Human neurotrophin 3 (NTF3), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
| RC214226L4 | Lenti ORF clone of Human neurotrophin 3 (NTF3), transcript variant 2, mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China