NTH1 (NTHL1) (NM_002528) Human Untagged Clone

CAT#: SC303213

NTHL1 (untagged)-Human nth endonuclease III-like 1 (E. coli) (NTHL1)


  "NM_002528" in other vectors (4)

Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "NTHL1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NTHL1
Synonyms FAP3; hNTH1; NTH1; OCTS3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_002528 edited
GGGATGTGTAGTCCGCAGGAGTCCGGCATGACCGCCTTGAGCGCGAGGATGCTGACCCGG
AGCCGGAGCCTGGGACCCGGGGCTGGGCCGCGGGGGTGTAGGGAGGAGCCCGGGCCTCTC
CGGAGAAGAGAGGCTGCAGCAGAAGCGAGGAAAAGCCACAGCCCCGTGAAGCGTCCGCGG
AAAGCACAGAGACTGCGTGTGGCCTATGAGGGCTCGGACAGTGAGAAAGGTGAGGGGGCT
GAGCCCCTCAAGGTGCCAGTCTGGGAGCCCCAGGACTGGCAGCAACAGCTGGTCAACATC
CGTGCCATGAGGAACAAAAAGGATGCACCTGTGGACCATCTGGGGACTGAGCACTGCTAT
GACTCCAGTGCCCCCCCAAAGGTACGCAGGTACCAGGTGCTGCTGTCACTGATGCTCTCC
AGCCAAACCAAAGACCAGGTGACGGCGGGCGCCATGCAGCGACTGCGGGCGCGGGGCCTG
ACGGTGGACAGCATCCTGCAGACAGATGATGCCACGCTGGGCAAGCTCATCTACCCCGTC
GGTTTCTGGAGGAGCAAGGTGAAATACATCAAGCAGACCAGCGCCATCCTGCAGCAGCAC
TACGGTGGGGACATCCCAGCCTCTGTGGCCGAGCTGGTGGCGCTGCCGGGTGTTGGGCCC
AAGATGGCACACCTGGCTATGGCTGTGGCCTGGGGCACTGTGTCAGGCATTGCAGTGGAC
ACGCATGTGCACAGAATCGCCAACAGGCTGAGGTGGACCAAGAAGGCAACCAAGTCCCCA
GAGGAGACCCGCGCCGCCCTGGAGGAGTGGCTGCCTAGGGAGCTGTGGCACGAGATCAAT
GGACTCTTGGTGGGCTTCGGCCAGCAGACCTGTCTGCCTGTGCACCCTCGCTGCCACGCC
TGCCTCAACCAAGCCCTCTGCCCGGCCGCCCAGGGTCTCTGATGGCCGCATGGCTCTGGC
CGAGGTGCCGCTGTGGCCACCGTCTGTGAAGTGGCTTTACGCTTCAGGAAGCCACGCCTG
TTGAATAAAGCTTTGGTGTGTTTGCAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_002528
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002528.4.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002528.4, NP_002519.1
RefSeq Size 1097 bp
RefSeq ORF 939 bp
Locus ID 4913
Cytogenetics 16p13.3
Protein Families Druggable Genome, Stem cell - Pluripotency
Protein Pathways Base excision repair
Gene Summary 'The protein encoded by this gene is a DNA N-glycosylase of the endonuclease III family. Like a similar protein in E. coli, the encoded protein has DNA glycosylase activity on DNA substrates containing oxidized pyrimidine residues and has apurinic/apyrimidinic lyase activity. [provided by RefSeq, Oct 2008]'
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.