PDE6 gamma (PDE6G) (NM_002602) Human Untagged Clone

CAT#: SC303224

PDE6G (untagged)-Human phosphodiesterase 6G, cGMP-specific, rod, gamma (PDE6G), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PDE6G
• Synonyms: PDEG; RP57
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_002602, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACCTGGAACCGCCCAAGGCTGAGTTCCGGTCAGCCACCAGGGTGGCCGGGGGACCTGTCACCCCCA
  GGAAAGGGCCCCCTAAATTTAAGCAGCGACAGACCAGGCAGTTCAAGAGCAAGCCCCCAAAGAAAGGCGT
  TCAAGGGTTTGGGGACGACATCCCTGGAATGGAAGGCCTGGGAACAGACATCACAGTCATCTGCCCTTGG
  GAGGCCTTCAACCACCTGGAGCTGCACGAGCTGGCCCAATATGGCATCATCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_002602
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002602.3, NP_002593.1
• RefSeq Size: 1064 bp
• RefSeq ORF: 264 bp
• Locus ID: 5148
• Cytogenetics: 17q25.3
• Protein Families: Druggable Genome
• Protein Pathways: Progesterone-mediated oocyte maturation, Purine metabolism
• Gene Summary: 'This gene encodes the gamma subunit of cyclic GMP-phosphodiesterase, which is composed of alpha- and beta- catalytic subunits and two identical, inhibitory gamma subunits. This gene is expressed in rod photoreceptors and functions in the phototransduction signaling cascade. It is also expressed in a variety of other tissues, and has been shown to regulate the c-Src protein kinase and G-protein-coupled receptor kinase 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2009]'
  Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 3, and 4 all encode the same protein.