PSG7 (NM_002783) Human Untagged Clone

CAT#: SC303243

PSG7 (untagged)-Human pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene) (PSG7), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PSG7
• Synonyms: PSBG-7; PSG1; PSGGA
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_002783, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGCCCCTCTCAGCCCCTCCCTGCACACAGCATATAACCTGGAAAGGGCTCCTGCTCACAGCATCAC
  TTTTAAACTTCTGGAACCCGCCCACCACAGCCCAAGTCACGATTGAAGCCCAGCCACCAAAAGTTTCCGA
  GGGGAAGGATGTTCTTCTACTTGTCCACAATTTGCCCCAGAATCTTACTGGCTACATCTGGTACAAAGGA
  CAAATCAGGGACCTCTACCATTATGTTACATCATATATAGTAGACGGTCAAATAATTAAATATGGGCCTG
  CATACAGTGGACGAGAAACAGTATATTCCAATGCATCCCTGCTGATCCAGAATGTCACCCAGGAAGACAC
  AGGATCCTACACTTTACACATCATAAAGCGAGGTGATGGGACTGGAGGAGTAACTGGACGTTTCACCTTC
  ACCTTATACCTGGAGACTCCCAAACCCTCCATCTCCAGCAGCAATTTCAACCCCAGGGAGGCCACGGAGG
  CTGTGATTTTAACCTGTGATCCTGAGACTCCAGATGCAAGCTACCTGTGGTGGATGAATGGTCAGAGCCT
  CCCTATGACTCACAGCTTGCAGCTGTCTGAAACCAACAGGACCCTCTACCTATTTGGTGTCACAAACTAT
  ACTGCAGGACCCTATGAATGTGAAATACGGAACCCAGTGAGTGCCAGCCGCAGTGACCCAGTCACCCTGA
  ATCTCCTCCCGAAGCTGCCCAAGCCCTACATCACCATCAATAACTTAAACCCCAGGGAGAATAAGGATGT
  CTCAACCTTCACCTGTGAACCTAAGAGTGAGAACTACACCTACATTTGGTGGCTAAATGGTCAGAGCCTC
  CCGGTCAGTCCCAGGGTAAAGCGACGCATTGAAAACAGGATCCTCATTCTACCCAGTGTCACGAGAAATG
  AAACAGGACCCTATCAATGTGAAATACGGGACCGATATGGTGGCATCCGCAGTGACCCAGTCACCCTGAA
  TGTCCTCTATGGTCCAGACCTCCCCAGAATTTACCCTTCATTCACCTATTACCATTCAGGACAAAACCTC
  TACTTGTCCTGCTTTGCGGACTCTAACCCACCGGCACAGTATTCTTGGACAATTAATGGGAAGTTTCAGC
  TATCAGGACAAAAGCTTTCTATCCCCCAGATTACTACAAAGCATAGCGGGCTCTATGCTTGCTCTGTTCG
  TAACTCAGCCACTGGCAAGGAAAGCTCCAAATCCGTGACAGTCAGAGTCTCTGACTGGACATTACCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_002783
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002783.2, NP_002774.2
• RefSeq Size: 2046 bp
• RefSeq ORF: 1260 bp
• Locus ID: 5676
• Cytogenetics: 19q13.31
• Protein Families: Secreted Protein
• Gene Summary: 'This gene is a member of the pregnancy-specific glycoprotein (PSG) gene family. The PSG genes are a subgroup of the carcinoembryonic antigen (CEA) family of immunoglobulin-like genes, and are found in a gene cluster at 19q13.1-q13.2 telomeric to another cluster of CEA-related genes. The PSG genes are expressed by placental trophoblasts and released into the maternal circulation during pregnancy, and are thought to be essential for maintenance of normal pregnancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]'
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longest isoform (1). This version of transcript variant 1 represents the protein-coding minority allele. A second version of transcript variant 1 represents the major allele of this polymorphic locus with a mismatch compared to the reference genome sequence.