Parvalbumin (PVALB) (NM_002854) Human Untagged Clone

CAT#: SC303247

PVALB (untagged)-Human parvalbumin (PVALB)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PVALB
• Synonyms: D22S749
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_002854 edited
  CCAGCCTTTCAGTGCAGGCTCCAGCCCTCCACCCCCACCCGAGTTGCAGGATGTCGATGA
  CAGACTTGCTGAACGCTGAGGACATCAAGAAGGCGGTGGGAGCCTTTAGCGCTACCGACT
  CCTTCGACCACAAAAAGTTCTTCCAAATGGTCGGCCTGAAGAAAAAGAGTGCGGATGATG
  TGAAGAAGGTGTTTCACATGCTGGACAAGGACAAAAGTGGCTTCATCGAGGAGGATGAGC
  TGGGATTCATCCTAAAAGGCTTCTCCCCAGATGCCAGAGACCTGTCTGCTAAAGAAACCA
  AGATGCTGATGGCTGCTGGAGACAAAGATGGGGACGGCAAAATTGGGGTTGACGAATTCT
  CCACTCTGGTGGCTGAAAGCTAAGAAGCACTGACTGCCCCTGGTCTTCCACCTCTCTG
  
• Restriction Sites: Please inquire
• ACCN: NM_002854
• Insert Size: 400 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002854.2.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002854.2, NP_002845.1
• RefSeq Size: 586 bp
• RefSeq ORF: 333 bp
• Locus ID: 5816
• Cytogenetics: 22q12.3
• Gene Summary: 'The protein encoded by this gene is a high affinity calcium ion-binding protein that is structurally and functionally similar to calmodulin and troponin C. The encoded protein is thought to be involved in muscle relaxation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]'
  Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.