TARC (CCL17) (NM_002987) Human Untagged Clone
CAT#: SC303258
CCL17 (untagged)-Human chemokine (C-C motif) ligand 17 (CCL17)
"NM_002987" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CCL17 |
| Synonyms | A-152E5.3; ABCD-2; SCYA17; TARC |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_002987, the custom clone sequence may differ by one or more nucleotides
ATGGCCCCACTGAAGATGCTGGCCCTGGTCACCCTCCTCCTGGGGGCTTCTCTGCAGCACATCCACGCAG CTCGAGGGACCAATGTGGGCCGGGAGTGCTGCCTGGAGTACTTCAAGGGAGCCATTCCCCTTAGAAAGCT GAAGACGTGGTACCAGACATCTGAGGACTGCTCCAGGGATGCCATCGTTTTTGTAACTGTGCAGGGCAGG GCCATCTGTTCGGACCCCAACAACAAGAGAGTGAAGAATGCAGTTAAATACCTGCAAAGCCTTGAGAGGT CTTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_002987 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_002987.2, NP_002978.1 |
| RefSeq Size | 615 bp |
| RefSeq ORF | 285 bp |
| Locus ID | 6361 |
| Cytogenetics | 16q21 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction |
| Gene Summary | 'This antimicrobial gene is one of several Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 16. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for T lymphocytes, but not monocytes or granulocytes. The product of this gene binds to chemokine receptors CCR4 and CCR8. This chemokine plays important roles in T cell development in thymus as well as in trafficking and activation of mature T cells. [provided by RefSeq, Sep 2014]' |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218569 | CCL17 (Myc-DDK-tagged)-Human chemokine (C-C motif) ligand 17 (CCL17) |
USD 150.00 |
|
| RG218569 | CCL17 (GFP-tagged) - Human chemokine (C-C motif) ligand 17 (CCL17) |
USD 460.00 |
|
| RC218569L1 | Lenti ORF clone of Human chemokine (C-C motif) ligand 17 (CCL17), Myc-DDK-tagged |
USD 768.00 |
|
| RC218569L2 | Lenti ORF clone of Human chemokine (C-C motif) ligand 17 (CCL17), mGFP tagged |
USD 620.00 |
|
| RC218569L3 | Lenti ORF clone of Human chemokine (C-C motif) ligand 17 (CCL17), Myc-DDK-tagged |
USD 620.00 |
|
| RC218569L4 | Lenti ORF clone of Human chemokine (C-C motif) ligand 17 (CCL17), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China