SULT2A1 (NM_003167) Human Untagged Clone

CAT#: SC303280

SULT2A1 (untagged)-Human sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 (SULT2A1)


  "NM_003167" in other vectors (4)

Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "SULT2A1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SULT2A1
Synonyms DHEA-ST; DHEAS; HST; hSTa; ST2; ST2A1; ST2A3; STD
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_003167 edited
ATGTCGGACGATTTCTTATGGTTTGAAGGCATAGCTTTCCCTACTATGGGTTTCAGATCC
GAAACCTTAAGAAAAGTACGTGATGAGTTCGTGATAAGGGATGAAGATGTAATAATATTG
ACTTACCCCAAATCAGGAACAAACTGGTTGGCTGAGATTCTCTGCCTGATGCACTCCAAG
GGGGATGCCAAGTGGATCCAATCTGTGCCCATCTGGGAGCGATCACCCTGGGTAGAGAGT
GAGATTGGGTATACAGCACTCAGTGAAACGGAGAGTCCACGTTTATTCTCCTCCCACCTC
CCCATCCAGTTATTCCCCAAGTCTTTCTTCAGTTCCAAGGCCAAGGTGATTTATCTCATG
AGAAATCCCAGAGATGTTTTGGTGTCTGGTTATTTTTTCTGGAAAAACATGAAGTTTATT
AAGAAACCAAAGTCATGGGAAGAATATTTTGAATGGTTTTGTCAAGGAACTGTGCTATAT
GGGTCATGGTTTGACCACATTCATGGCTGGATGCCCATGAGAGAGGAGAAAAACTTCCTG
TTACTGAGTTATGAGGAGCTGAAACAGGACACAGGAAGAACCATAGAGAAGATCTGTCAA
TTCCTGGGAAAGACGTTAGAACCCGAAGAACTGAACTTAATTCTCAAGAACAGCTCCTTT
CAGAGCATGAAAGAAAACAAGATGTCCAATTATTCCCTCCTGAGTGTTGATTATGTAGTG
GACAAAGCACAACTTCTGAGAAAAGGTGTATCTGGGGACTGGAAAAATCACTTCACAGTG
GCCCAAGCTGAAGACTTTGATAAATTGTTCCAAGAGAAGATGGCAGATCTTCCTCGAGAG
CTGTTCCCATGGGAATAA
Restriction Sites Please inquire     
ACCN NM_003167
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_003167.2.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003167.2, NP_003158.2
RefSeq Size 1779 bp
RefSeq ORF 858 bp
Locus ID 6822
Cytogenetics 19q13.33
Gene Summary 'This gene encodes a member of the sulfotransferase family. Sulfotransferases aid in the metabolism of drugs and endogenous compounds by converting these substances into more hydrophilic water-soluble sulfate conjugates that can be easily excreted. This protein catalyzes the sulfation of steroids and bile acids in the liver and adrenal glands, and may have a role in the inherited adrenal androgen excess in women with polycystic ovary syndrome. [provided by RefSeq, Mar 2010]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.