XRCC4 (NM_003401) Human Untagged Clone
CAT#: SC303300
XRCC4 (untagged)-Human X-ray repair complementing defective repair in Chinese hamster cells 4 (XRCC4), transcript variant 1
"NM_003401" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | XRCC4 |
| Synonyms | SSMED |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_003401, the custom clone sequence may differ by one or more nucleotides
ATGGAGAGAAAAATAAGCAGAATCCACCTTGTTTCTGAACCCAGTATAACTCATTTTCTACAAGTATCTT GGGAGAAAACACTGGAATCTGGTTTTGTTATTACACTTACTGATGGTCATTCAGCATGGACTGGGACAGT TTCTGAATCAGAGATTTCCCAAGAAGCTGATGACATGGCAATGGAAAAAGGGAAATATGTTGGTGAACTG AGAAAAGCATTGTTGTCAGGAGCAGGACCAGCTGATGTATACACGTTTAATTTTTCTAAAGAGTCTTGTT ATTTCTTCTTTGAGAAAAACCTGAAAGATGTCTCATTCAGACTTGGTTCCTTCAACCTAGAGAAAGTTGA AAACCCAGCTGAAGTCATTAGAGAACTTATTTGTTATTGCTTGGACACCATTGCAGAAAATCAAGCCAAA AATGAGCACCTGCAGAAAGAAAATGAAAGGCTTCTGAGAGATTGGAATGATGTTCAAGGACGATTTGAAA AATGTGTGAGTGCTAAGGAAGCTTTGGAGACTGATCTTTATAAGCGGTTTATTCTGGTGTTGAATGAGAA GAAAACAAAAATCAGAAGTTTGCATAATAAATTATTAAATGCAGCTCAAGAACGAGAAAAGGACATCAAA CAAGAAGGGGAAACTGCAATCTGTTCTGAAATGACTGCTGACCGAGATCCAGTCTATGATGAGAGTACTG ATGAGGAAAGTGAAAACCAAACTGATCTCTCTGGGTTGGCTTCAGCTGCTGTAAGTAAAGATGATTCCAT TATTTCAAGTCTTGATGTCACTGATATTGCACCAAGTAGAAAAAGGAGACAGCGAATGCAAAGAAATCTT GGGACAGAACCTAAAATGGCTCCTCAGGAGAATCAGCTTCAAGAAAAGGAAAAGCCTGATTCTTCACTAC CTGAGACGTCTAAAAAGGAGCACATCTCAGCTGAAAACATGTCTTTAGAAACTCTGAGAAACAGCAGCCC AGAAGACCTCTTTGATGAGATTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_003401 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_003401.4, NP_003392.1 |
| RefSeq Size | 1777 bp |
| RefSeq ORF | 1005 bp |
| Locus ID | 7518 |
| Cytogenetics | 5q14.2 |
| Protein Families | Druggable Genome |
| Protein Pathways | Non-homologous end-joining |
| Gene Summary | 'The protein encoded by this gene functions together with DNA ligase IV and the DNA-dependent protein kinase in the repair of DNA double-strand breaks. This protein plays a role in both non-homologous end joining and the completion of V(D)J recombination. Mutations in this gene can cause short stature, microcephaly, and endocrine dysfunction (SSMED). Alternate transcript variants such as NM_022406 are unlikely to be expressed in some individuals due to a polymorphism (rs1805377) in the last splice acceptor site. [provided by RefSeq, Oct 2019]' Transcript Variant: This variant (1) encodes isoform 1. Variants 1 and 3 encode the same isoform (1). |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212684 | XRCC4 (Myc-DDK-tagged)-Human X-ray repair complementing defective repair in Chinese hamster cells 4 (XRCC4), transcript variant 1 |
USD 457.00 |
|
| RG212684 | XRCC4 (GFP-tagged) - Human X-ray repair complementing defective repair in Chinese hamster cells 4 (XRCC4), transcript variant 1 |
USD 460.00 |
|
| RC212684L1 | Lenti ORF clone of Human X-ray repair complementing defective repair in Chinese hamster cells 4 (XRCC4), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
| RC212684L2 | Lenti ORF clone of Human X-ray repair complementing defective repair in Chinese hamster cells 4 (XRCC4), transcript variant 1, mGFP tagged |
USD 620.00 |
|
| RC212684L3 | Lenti ORF clone of Human X-ray repair complementing defective repair in Chinese hamster cells 4 (XRCC4), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
| RC212684L4 | Lenti ORF clone of Human X-ray repair complementing defective repair in Chinese hamster cells 4 (XRCC4), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China