ZIC3 (NM_003413) Human Untagged Clone

CAT#: SC303302

ZIC3 (untagged)-Human Zic family member 3 (ZIC3)


  "NM_003413" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZIC3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZIC3
Synonyms HTX; HTX1; VACTERLX; ZNF203
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_003413, the custom clone sequence may differ by one or more nucleotides


ATGACGATGCTCCTGGACGGAGGCCCGCAGTTCCCTGGGCTGGGAGTGGGCAGCTTCGGCGCGCCGCGCC
ACCACGAGATGCCCAACCGTGAGCCGGCAGGCATGGGGCTGAATCCCTTCGGGGACTCAACCCACGCCGC
CGCCGCCGCCGCCGCCGCCGCTGCCTTCAAGCTGAGCCCTGCCGCGGCGCACGATCTATCTTCAGGCCAG
AGCTCGGCTTTCACGCCGCAGGGTTCGGGCTACGCCAACGCCCTGGGCCACCATCACCACCACCATCACC
ATCATCACCACACCAGCCAGGTGCCCAGCTACGGTGGCGCTGCCTCTGCCGCCTTCAACTCAACGCGCGA
GTTTCTGTTCCGCCAGCGCAGCTCCGGGCTCAGTGAGGCGGCCTCGGGTGGCGGGCAGCACGGGCTCTTC
GCCGGCTCGGCGAGCAGCCTGCATGCTCCAGCTGGCATCCCCGAGCCCCCTAGCTACTTGCTGTTTCCCG
GGCTGCATGAGCAGGGCGCTGGGCACCCGTCGCCCACAGGGCACGTGGACAACAACCAGGTCCACCTGGG
GCTGCGTGGGGAGCTGTTCGGCCGTGCTGACCCATACCGCCCAGTGGCCAGCCCGCGCACGGACCCCTAC
GCGGCCGGCGCTCAGTTTCCTAACTACAGCCCCATGAACATGAACATGGGAGTGAACGTGGCGGCCCACC
ACGGGCCCGGCGCCTTCTTCCGTTATATGCGGCAGCCTATCAAGCAGGAGCTGTCGTGCAAGTGGATCGA
CGAGGCTCAGCTGAGCCGGCCCAAGAAGAGCTGCGACCGGACCTTCAGCACCATGCATGAGCTGGTGACA
CATGTCACCATGGAGCATGTGGGGGGCCCGGAGCAGAACAACCACGTCTGCTACTGGGAGGAGTGCCCCC
GGGAGGGCAAGTCTTTCAAGGCGAAGTACAAACTGGTCAACCACATCCGAGTGCACACGGGCGAGAAGCC
CTTCCCATGCCCCTTCCCGGGCTGCGGGAAGATCTTTGCCCGTTCTGAGAACCTCAAGATCCACAAGAGG
ACCCACACAGGTGAGAAACCTTTCAAATGTGAATTTGAAGGCTGTGACAGACGCTTTGCCAACAGCAGCG
ACCGTAAGAAGCACATGCATGTGCATACCTCGGACAAGCCCTATATCTGCAAAGTGTGCGACAAGTCCTA
CACGCACCCGAGCTCCCTGCGCAAACACATGAAGGTTCATGAATCTCAAGGGTCAGATTCCTCCCCTGCT
GCCAGTTCAGGCTATGAATCTTCCACTCCACCCGCTATAGCTTCTGCAAACAGTAAAGATACCACTAAAA
CCCCTTCTGCAGTTCAAACTAGCACCAGCCACAACCCTGGACTTCCTCCTAATTTTAACGAATGGTACGT
CTGA


Restriction Sites SgfI-MluI     
ACCN NM_003413
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003413.3, NP_003404.1
RefSeq Size 3939 bp
RefSeq ORF 1404 bp
Locus ID 7547
Cytogenetics Xq26.3
Protein Families Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS
Gene Summary 'This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This nuclear protein probably functions as a transcription factor in early stages of left-right body axis formation. Mutations in this gene cause X-linked visceral heterotaxy, which includes congenital heart disease and left-right axis defects in organs. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (1, also known as ZIC3-A) represents the longer transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.