HIST1H2AK (HIST1H2AI) (NM_003509) Human Untagged Clone

CAT#: SC303323

HIST1H2AI (untagged)-Human histone cluster 1, H2ai (HIST1H2AI)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HIST1H2AI
• Synonyms: H2A/c; H2AFC
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_003509, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCTGGGCGTGGCAAGCAGGGAGGCAAAGCTCGCGCCAAGGCCAAGACCCGCTCTTCTCGGGCCGGGC
  TTCAGTTTCCCGTAGGCCGAGTGCATCGCCTGCTCCGCAAAGGCAACTATGCGGAGCGGGTCGGTGCTGG
  AGCGCCGGTGTACCTGGCGGCGGTGCTGGAGTACCTGACCGCCGAGATCCTGGAGCTGGCTGGCAACGCG
  GCCCGCGACAACAAGAAGACTCGCATCATCCCGCGTCACCTCCAGCTGGCCATCCGCAACGATGAGGAGC
  TCAACAAGCTTCTGGGCAAAGTCACCATCGCACAGGGTGGCGTCCTGCCCAACATCCAGGCCGTGCTACT
  GCCCAAGAAGACCGAGAGCCACCACAAGGCGAAGGGCAAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_003509
• ORF Size: 393 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_003509.2, NP_003500.1
• RefSeq Size: 469
• RefSeq ORF: 393
• Locus ID: 8329
• Protein Pathways: Systemic lupus erythematosus
• Gene Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015]