PLA2G10 (NM_003561) Human Untagged Clone

CAT#: SC303347

PLA2G10 (untagged)-Human phospholipase A2, group X (PLA2G10)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PLA2G10
• Synonyms: GXPLA2; GXSPLA2; SPLA2; sPLA2-X
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_003561, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGCCGCTACCTGTGTGCCTGCCAATCATGCTGCTCCTGCTACTGCCGTCGCTGCTGCTGCTGCTGC
  TTCTACCTGGCCCCGGGTCCGGCGAGGCCTCCAGGATATTACGTGTGCACCGGCGTGGGATCCTGGAACT
  GGCAGGAACTGTGGGTTGTGTTGGTCCCCGAACCCCCATCGCCTATATGAAATATGGTTGCTTTTGTGGC
  TTGGGAGGCCATGGCCAGCCCCGCGATGCCATTGACTGGTGCTGCCATGGCCACGACTGTTGTTACACTC
  GAGCTGAGGAGGCCGGCTGCAGCCCCAAGACAGAGCGCTACTCCTGGCAGTGCGTCAATCAGAGCGTCCT
  GTGCGGACCGGCAGAGAACAAATGCCAAGAACTGTTGTGCAAGTGTGACCAGGAGATTGCTAACTGCTTA
  GCCCAAACTGAGTACAACTTAAAGTACCTCTTCTACCCCCAGTTCCTATGTGAGCCGGACTCGCCCAAGT
  GTGACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_003561
• ORF Size: 498 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_003561.2, NP_003552.1
• RefSeq Size: 924
• RefSeq ORF: 498
• Locus ID: 8399
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Protein Pathways: alpha-Linolenic acid metabolism, Arachidonic acid metabolism, Ether lipid metabolism, Fc epsilon RI signaling pathway, Glycerophospholipid metabolism, GnRH signaling pathway, Linoleic acid metabolism, Long-term depression, MAPK signaling pathway, Metabolic pathways, Vascular smooth muscle contraction, VEGF signaling pathway
• Gene Summary: This gene encodes a member of the phospholipase A2 family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature enzyme. This calcium-dependent enzyme hydrolyzes glycerophospholipids to produce free fatty acids and lysophospholipids. In one example, this enzyme catalyzes the release of arachidonic acid from cell membrane phospholipids, thus playing a role in the production of various inflammatory lipid mediators, such as prostaglandins. The encoded protein may promote the survival of breast cancer cells through its role in lipid metabolism. [provided by RefSeq, Nov 2015]
  Transcript Variant: This variant (1) represents the protein-coding transcript.