WISP1 (NM_003882) Human Untagged Clone

CAT#: SC303397

WISP1 (untagged)-Human WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: WISP1
• Synonyms: WISP1; WISP1-OT1; WISP1-UT1; WISP1c; WISP1i; WISP1tc
• Vector: pCMV6-XL6
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_003882 edited
  GTCGATGCCTGTGCCACTGACGTCCAGGCATGAGGTGGTTCCTGCCCTGGACGCTGGCAG
  CAGTGACAGCAGCAGCCGCCAGCACCGTCCTGGCCACGGCCCTCTCTCCAGCCCCTACGA
  CCATGGACTTTACCCCAGCTCCACTGGAGGACACCTCCTCACGCCCCCAATTCTGCAAGT
  GGCCATGTGAGTGCCCGCCATCCCCACCCCGCTGCCCGCTGGGGGTCAGCCTCATCACAG
  ATGGCTGTGAGTGCTGTAAGATGTGCGCTCAGCAGCTTGGGGACAACTGCACGGAGGCTG
  CCATCTGTGACCCCCACCGGGGCCTCTACTGTGACTACAGCGGGGACCGCCCGAGGTACG
  CAATAGGAGTGTGTGCACAGGTGGTCGGTGTGGGCTGCGTCCTGGATGGGGTGCGCTACA
  ACAACGGCCAGTCCTTCCAGCCTAACTGCAAGTACAACTGCACGTGCATCGACGGCGCGG
  TGGGCTGCACACCACTGTGCCTCCGAGTGCGCCCCCCGCGTCTCTGGTGCCCCCACCCGC
  GGCGCGTGAGCATACCTGGCCACTGCTGTGAGCAGTGGGTATGTGAGGACGACGCCAAGA
  GGCCACGCAAGACCGCACCCCGTGACACAGGAGCCTTCGATGCTGTGGGTGAGGTGGAGG
  CATGGCACAGGAACTGCATAGCCTACACAAGCCCCTGGAGCCCTTGCTCCACCAGCTGCG
  GCCTGGGGGTCTCCACTCGGATCTCCAATGTTAACGCCCAGTGCTGGCCTGAGCAAGAGA
  GCCGCCTCTGCAACTTGCGGCCATGCGATGTGGACATCCATACACTCATTAAGGCAGGGA
  AGAAGTGTCTGGCTGTGTACCAGCCAGAGGCATCCATGAACTTCACACTTGCGGGCTGCA
  TCAGCACACGCTCCTATCAACCCAAGTACTGTGGAGTTTGCATGGACAATAGGTGCTGCA
  TCCCCTACAAGTCTAAGACTATCGACGTGTCCTTCCAGTGTCCTGATGGGCTTGGCTTCT
  CCCGCCAGGTCCTATGGATTAATGCCTGCTTCTGTAACCTGAGCTGTAGGAATCCCAATG
  ACATCTTTGCTGACTTGGAATCCTACCCTGACTTCTCAGAAATTGCCAACTAGGCAGGCA
  CAAATCTTGGGTCT
  
• Restriction Sites: Please inquire
• ACCN: NM_003882
• ORF Size: 1104 bp
• Insert Size: 1150
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_003882.2.

Reference Data

• RefSeq: NM_003882.2, NP_003873.1
• RefSeq Size: 2819
• RefSeq ORF: 1104
• Locus ID: 8840
• Domains: IB, tsp_1, VWC, CT, Cys_knot
• Protein Families: Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Secreted Protein, Stem cell relevant signaling - DSL/Notch pathway, Stem cell relevant signaling - Wnt Signaling pathway
• Gene Summary: This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. It is expressed at a high level in fibroblast cells, and overexpressed in colon tumors. The encoded protein binds to decorin and biglycan, two members of a family of small leucine-rich proteoglycans present in the extracellular matrix of connective tissue, and possibly prevents the inhibitory activity of decorin and biglycan in tumor cell proliferation. It also attenuates p53-mediated apoptosis in response to DNA damage through activation of the Akt kinase. It is 83% identical to the mouse protein at the amino acid level. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2011]
  Transcript Variant: This variant (1) encodes the full length protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.