TM4SF5 (NM_003963) Human Untagged Clone
CAT#: SC303406
TM4SF5 (untagged)-Human transmembrane 4 L six family member 5 (TM4SF5)
"NM_003963" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TM4SF5 |
Synonyms | tetraspan transmembrane protein L6H; transmembrane 4 L six family member 5; transmembrane 4 superfamily member 5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_003963, the custom clone sequence may differ by one or more nucleotides
ATGTGTACGGGAAAATGTGCCCGCTGTGTGGGGCTCTCCCTCATTACCCTCTGCCTCGTCTGCATTGTGG CCAACGCCCTCCTGCTGGTACCTAATGGGGAGACCTCCTGGACCAACACCAACCATCTCAGCTTGCAAGT CTGGCTCATGGGCGGCTTCATTGGCGGGGGCCTAATGGTACTGTGTCCGGGGATTGCAGCCGTTCGGGCA GGGGGCAAGGGCTGCTGTGGTGCTGGGTGCTGTGGAAACCGCTGCAGGATGCTGCGCTCGGTCTTCTCCT CGGCGTTCGGGGTGCTTGGTGCCATCTACTGCCTCTCGGTGTCTGGAGCTGGGCTCCGAAATGGACCCAG ATGCTTAATGAACGGCGAGTGGGGCTACCACTTCGAAGACACCGCGGGAGCTTACTTGCTCAACCGCACT CTATGGGATCGGTGCGAGGCGCCCCCTCGCGTGGTCCCCTGGAATGTGACGCTCTTCTCGCTGCTGGTGG CCGCCTCCTGCCTGGAGATAGTACTGTGTGGGATCCAGCTGGTGAACGCGACCATTGGTGTCTTCTGCGG CGATTGCAGGAAAAAACAGGACACACCTCACTGA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | Please inquire |
ACCN | NM_003963 |
ORF Size | 594 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_003963.2, NP_003954.2 |
RefSeq Size | 708 |
RefSeq ORF | 594 |
Locus ID | 9032 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein and is highly similar in sequence and structure to transmembrane 4 superfamily member 1. It may play a role in cell proliferation, and overexpression of this protein may be associated with the uncontrolled growth of tumour cells. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210140 | TM4SF5 (Myc-DDK-tagged)-Human transmembrane 4 L six family member 5 (TM4SF5) |
USD 420.00 |
|
RG210140 | TM4SF5 (GFP-tagged) - Human transmembrane 4 L six family member 5 (TM4SF5) |
USD 460.00 |
|
RC210140L1 | Lenti-ORF clone of TM4SF5 (Myc-DDK-tagged)-Human transmembrane 4 L six family member 5 (TM4SF5) |
USD 768.00 |
|
RC210140L2 | Lenti-ORF clone of TM4SF5 (mGFP-tagged)-Human transmembrane 4 L six family member 5 (TM4SF5) |
USD 620.00 |
|
RC210140L3 | Lenti-ORF clone of TM4SF5 (Myc-DDK-tagged)-Human transmembrane 4 L six family member 5 (TM4SF5) |
USD 620.00 |
|
RC210140L4 | Lenti-ORF clone of TM4SF5 (mGFP-tagged)-Human transmembrane 4 L six family member 5 (TM4SF5) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review