TM4SF5 (NM_003963) Human Untagged Clone

CAT#: SC303406

TM4SF5 (untagged)-Human transmembrane 4 L six family member 5 (TM4SF5)


  "NM_003963" in other vectors (6)

Reconstitution Protocol

USD 540.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "TM4SF5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TM4SF5
Synonyms tetraspan transmembrane protein L6H; transmembrane 4 L six family member 5; transmembrane 4 superfamily member 5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_003963, the custom clone sequence may differ by one or more nucleotides


ATGTGTACGGGAAAATGTGCCCGCTGTGTGGGGCTCTCCCTCATTACCCTCTGCCTCGTCTGCATTGTGG
CCAACGCCCTCCTGCTGGTACCTAATGGGGAGACCTCCTGGACCAACACCAACCATCTCAGCTTGCAAGT
CTGGCTCATGGGCGGCTTCATTGGCGGGGGCCTAATGGTACTGTGTCCGGGGATTGCAGCCGTTCGGGCA
GGGGGCAAGGGCTGCTGTGGTGCTGGGTGCTGTGGAAACCGCTGCAGGATGCTGCGCTCGGTCTTCTCCT
CGGCGTTCGGGGTGCTTGGTGCCATCTACTGCCTCTCGGTGTCTGGAGCTGGGCTCCGAAATGGACCCAG
ATGCTTAATGAACGGCGAGTGGGGCTACCACTTCGAAGACACCGCGGGAGCTTACTTGCTCAACCGCACT
CTATGGGATCGGTGCGAGGCGCCCCCTCGCGTGGTCCCCTGGAATGTGACGCTCTTCTCGCTGCTGGTGG
CCGCCTCCTGCCTGGAGATAGTACTGTGTGGGATCCAGCTGGTGAACGCGACCATTGGTGTCTTCTGCGG
CGATTGCAGGAAAAAACAGGACACACCTCACTGA


Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites Please inquire     
ACCN NM_003963
ORF Size 594 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_003963.2, NP_003954.2
RefSeq Size 708
RefSeq ORF 594
Locus ID 9032
Protein Families Transmembrane
Gene Summary The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein and is highly similar in sequence and structure to transmembrane 4 superfamily member 1. It may play a role in cell proliferation, and overexpression of this protein may be associated with the uncontrolled growth of tumour cells. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.