GIP (NM_004123) Human Untagged Clone
CAT#: SC303436
GIP (untagged)-Human gastric inhibitory polypeptide (GIP)
"NM_004123" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | GIP |
| Synonyms | gastric inhibitory polypeptide; glucose-dependent insulinotropic polypeptide |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_004123 edited
AGGCTCAGAAGGTCCAGAAATCAGGGGAAGGAGACCCCTATCTGTCCTTCTTCTGGAAGA GCTGGAAAGGAAGTCTGCTCAGGAAATAACCTTGGAAGATGGTGGCCACGAAGACCTTTG CTCTGCTGCTGCTGTCCCTGTTCCTGGCAGTGGGACTAGGAGAGAAGAAAGAGGGTCACT TCAGCGCTCTCCCCTCCCTGCCTGTTGGATCTCATGCTAAGGTGAGCAGCCCTCAACCTC GAGGCCCCAGGTACGCGGAAGGGACTTTCATCAGTGACTACAGTATTGCCATGGACAAGA TTCACCAACAAGACTTTGTGAACTGGCTGCTGGCCCAAAAGGGGAAGAAGAATGACTGGA AACACAACATCACCCAGAGGGAGGCTCGGGCGCTGGAGCTGGCCGGTCAAGCTAATAGGA AGGAGGAGGAGGCAGTGGAGCCACAGAGCTCCCCAGCCAAGAACCCCAGCGATGAAGATT TGCTGCGGGACTTGCTGATTCAAGAGCTGTTGGCCTGCTTGCTGGATCAGACAAACCTCT GCAGGCTCAGGTCTCGGTGACTCTGACCACACCCAGCTCAGGACTGGATTCTGCCCTTCA CTTAGCACCTGCCTCAGCCCCACTCCAGAATAGCCAAGAGAACCCAAACCAATAAAGTTT ATGCTAAGTCGAGCCCATTGTGAAAATTTATTAAAATGACTACTGAGCACT |
| Restriction Sites | Please inquire |
| ACCN | NM_004123 |
| Insert Size | 700 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_004123.2. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_004123.2, NP_004114.1 |
| RefSeq Size | 711 bp |
| RefSeq ORF | 462 bp |
| Locus ID | 2695 |
| Cytogenetics | 17q21.32 |
| Protein Families | Druggable Genome, Secreted Protein |
| Gene Summary | 'This gene encodes an incretin hormone and belongs to the glucagon superfamily. The encoded protein is important in maintaining glucose homeostasis as it is a potent stimulator of insulin secretion from pancreatic beta-cells following food ingestion and nutrient absorption. This gene stimulates insulin secretion via its G protein-coupled receptor activation of adenylyl cyclase and other signal transduction pathways. It is a relatively poor inhibitor of gastric acid secretion. [provided by RefSeq, Jul 2008]' |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222456 | GIP (Myc-DDK-tagged)-Human gastric inhibitory polypeptide (GIP) |
USD 150.00 |
|
| RG222456 | GIP (GFP-tagged) - Human gastric inhibitory polypeptide (GIP) |
USD 460.00 |
|
| RC222456L1 | Lenti ORF clone of Human gastric inhibitory polypeptide (GIP), Myc-DDK-tagged |
USD 768.00 |
|
| RC222456L2 | Lenti ORF clone of Human gastric inhibitory polypeptide (GIP), mGFP tagged |
USD 620.00 |
|
| RC222456L3 | Lenti ORF clone of Human gastric inhibitory polypeptide (GIP), Myc-DDK-tagged |
USD 620.00 |
|
| RC222456L4 | Lenti ORF clone of Human gastric inhibitory polypeptide (GIP), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China