WNT2B (NM_004185) Human Untagged Clone
CAT#: SC303447
WNT2B (untagged)-Human wingless-type MMTV integration site family, member 2B (WNT2B), transcript variant WNT-2B1
"NM_004185" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | WNT2B |
Synonyms | WNT13 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_004185 edited
ATGTTGGATGGCCTTGGAGTGGTAGCCATAAGCATTTTTGGAATTCAACTAAAAACTGAA GGATCCTTGAGGACGGCAGTACCTGGCATACCTACACAGTCAGCGTTCAACAAGTGTTTG CAAAGGTACATTGGGGCACTGGGGGCACGAGTGATCTGTGACAATATCCCTGGTTTGGTG AGCCGGCAGCGGCAGCTGTGCCAGCGTTACCCAGACATCATGCGTTCAGTGGGCGAGGGT GCCCGAGAATGGATCCGAGAGTGTCAGCACCAATTCCGCCACCACCGCTGGAACTGTACC ACCCTGGACCGGGACCACACCGTCTTTGGCCGTGTCATGCTCAGAAGTAGCCGAGAGGCA GCTTTTGTATATGCCATCTCATCAGCAGGGGTAGTCCACGCTATTACTCGCGCCTGTAGC CAGGGTGAACTGAGTGTGTGCAGCTGTGACCCCTACACCCGTGGCCGACACCATGACCAG CGTGGGGACTTTGACTGGGGTGGCTGCAGTGACAACATCCACTACGGTGTCCGTTTTGCC AAGGCCTTCGTGGATGCCAAGGAGAAGAGGCTTAAGGATGCCCGGGCCCTCATGAACTTA CATAATAACCGCTGTGGTCGCACGGCTGTGCGGCGGTTTCTGAAGCTGGAGTGTAAGTGC CATGGCGTGAGTGGTTCCTGTACTCTGCGCACCTGCTGGCGTGCACTCTCAGATTTCCGC CGCACAGGTGATTACCTGCGGCGACGCTATGATGGGGCTGTGCAGGTGATGGCCACCCAA GATGGTGCCAACTTCACCGCAGCCCGCCAAGGCTATCGCCGTGCCACCCGGACTGATCTT GTCTACTTTGACAACTCTCCAGATTACTGTGTCTTGGACAAGGCTGCAGGTTCCCTAGGC ACTGCAGGCCGTGTCTGCAGCAAGACATCAAAAGGAACAGACGGTTGTGAAATCATGTGC TGTGGCCGAGGGTACGACACAACTCGAGTCACCCGTGTTACCCAGTGTGAGTGCAAATTC CACTGGTGCTGTGCTGTACGGTGCAAGGAATGCAGAAATACTGTGGACGTCCATACTTGC AAAGCCCCCAAGAAGGCAGAGTGGCTGGACCAAACCTGA |
Restriction Sites | Please inquire |
ACCN | NM_004185 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_004185.3. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_004185.2, NP_004176.2 |
RefSeq Size | 2014 bp |
RefSeq ORF | 1119 bp |
Locus ID | 7482 |
Cytogenetics | 1p13.2 |
Protein Families | Secreted Protein |
Protein Pathways | Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway |
Gene Summary | 'This gene encodes a member of the wingless-type MMTV integration site (WNT) family of highly conserved, secreted signaling factors. WNT family members function in a variety of developmental processes including regulation of cell growth and differentiation and are characterized by a WNT-core domain. This gene may play a role in human development as well as carcinogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]' Transcript Variant: This variant (WNT-2B1) differs in the 5' UTR and 5' coding region, compared to variant WNT-2B2. The encoded isoform (WNT-2B1) has a shorter and distinct N-terminus, compared to isoform WNT-2B2. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216086 | WNT2B (Myc-DDK-tagged)-Human wingless-type MMTV integration site family, member 2B (WNT2B), transcript variant WNT-2B1 |
USD 98.00 |
|
RG216086 | WNT2B (GFP-tagged) - Human wingless-type MMTV integration site family, member 2B (WNT2B), transcript variant WNT-2B1 |
USD 460.00 |
|
RC216086L1 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 2B (WNT2B), transcript variant WNT-2B1, Myc-DDK-tagged |
USD 768.00 |
|
RC216086L2 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 2B (WNT2B), transcript variant WNT-2B1, mGFP tagged |
USD 620.00 |
|
RC216086L3 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 2B (WNT2B), transcript variant WNT-2B1, Myc-DDK-tagged |
USD 768.00 |
|
RC216086L4 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 2B (WNT2B), transcript variant WNT-2B1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review