FOXE1 (NM_004473) Human Untagged Clone

CAT#: SC303486

FOXE1 (untagged)-Human forkhead box E1 (thyroid transcription factor 2) (FOXE1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FOXE1
• Synonyms: FKHL15; FOXE2; HFKH4; HFKL5; NMTC4; TITF2; TTF-2; TTF2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_004473, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACTGCCGAGAGCGGGCCGCCGCCGCCGCAGCCGGAGGTGCTGGCTACCGTGAAGGAAGAGCGCGGCG
  AGACGGCAGCAGGGGCCGGGGTCCCAGGGGAGGCCACGGGCCGCGGGGCGGGCGGGCGGCGCCGCAAGCG
  CCCCCTGCAGCGCGGGAAGCCGCCCTACAGCTACATCGCGCTCATCGCCATGGCCATCGCGCACGCGCCC
  GAGCGCCGCCTCACGCTGGGCGGCATCTACAAGTTCATCACCGAGCGCTTCCCCTTCTACCGCGACAACC
  CCAAAAAGTGGCAGAACAGCATCCGCCACAACCTCACACTCAACGACTGCTTCCTCAAGATCCCGCGCGA
  GGCCGGCCGCCCGGGTAAGGGCAACTACTGGGCGCTTGACCCCAACGCGGAGGACATGTTCGAGAGCGGC
  AGCTTCCTGCGCCGCCGCAAGCGCTTCAAGCGCTCGGACCTCTCCACCTACCCGGCTTACATGCACGACG
  CGGCGGCTGCCGCAGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCATCTTCCCAGGCGCGGTGCCCGC
  CGCGCGCCCCCCCTACCCGGGCGCCGTCTATGCAGGCTACGCGCCGCCGTCGCTGGCCGCGCCGCCTCCA
  GTCTACTACCCCGCGGCGTCGCCCGGCCCTTGCCGCGTCTTCGGCCTGGTTCCTGAGCGGCCGCTCAGCC
  CAGAGCTGGGGCCCGCACCGTCGGGGCCCGGCGGCTCTTGCGCCTTTGCCTCCGCCGGCGCCCCCGCTAC
  CACCACCGGCTACCAGCCCGCAGGCTGCACCGGGGCCCGGCCGGCCAACCCCTCCGCCTATGCGGCTGCC
  TACGCGGGCCCCGACGGCGCGTACCCGCAGGGCGCCGGCAGTGCGATCTTTGCCGCTGCTGGCCGCCTGG
  CGGGACCCGCTTCGCCCCCAGCGGGCGGCAGCAGTGGCGGCGTGGAGACCACGGTGGACTTCTACGGGCG
  CACGTCGCCCGGCCAGTTCGGAGCGCTGGGAGCCTGCTACAACCCTGGCGGGCAGCTCGGAGGGGCCAGT
  GCAGGCGCCTACCATGCTCGCCATGCTGCCGCTTATCCCGGTGGGATAGATCGGTTCGTGTCCGCCATGT
  GA
  
  
• Restriction Sites: Please inquire
• ACCN: NM_004473
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_004473.3, NP_004464.2
• RefSeq Size: 3473 bp
• RefSeq ORF: 1122 bp
• Locus ID: 2304
• Cytogenetics: 9q22.33
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: 'This intronless gene encodes a protein that belongs to the forkhead family of transcription factors. Members of this family contain a conserved 100-amino acid DNA-binding 'forkhead' domain. The encoded protein functions as a thyroid transcription factor that plays a role in thyroid morphogenesis. Mutations in this gene are associated with the Bamforth-Lazarus syndrome, and with susceptibility to nonmedullary thyroid cancer-4. [provided by RefSeq, Nov 2016]'