CD42d (GP5) (NM_004488) Human Untagged Clone

CAT#: SC303489

GP5 (untagged)-Human glycoprotein V (platelet) (GP5)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GP5
• Synonyms: CD42d; GPV
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_004488, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGAGGGGGACTCTACTGTGCGCGGTGCTCGGGCTTCTGCGCGCCCAGCCCTTCCCCTGTCCGCCAG
  CTTGCAAGTGTGTCTTCCGGGACGCCGCGCAGTGCTCGGGGGGCGACGTGGCGCGCATCTCCGCGCTAGG
  CCTGCCCACCAACCTCACGCACATCCTGCTCTTCGGAATGGGCCGCGGCGTCCTGCAGAGCCAGAGCTTC
  AGCGGCATGACCGTCCTGCAGCGCCTCATGATCTCCGACAGCCACATTTCCGCCGTTGCCCCCGGCACCT
  TCAGTGACCTGATAAAACTGAAAACCCTGAGGCTGTCGCGCAACAAAATCACGCATCTTCCAGGTGCGCT
  GCTGGATAAGATGGTGCTCCTGGAGCAGTTGTTTTTGGACCACAATGCGCTAAGGGGCATTGACCAAAAC
  ATGTTTCAGAAACTGGTTAACCTGCAGGAGCTCGCTCTGAACCAGAATCAGCTCGATTTCCTTCCTGCCA
  GTCTCTTCACGAATCTGGAGAACCTGAAGTTGTTGGATTTATCGGGAAACAACCTGACCCACCTGCCCAA
  GGGGTTGCTTGGAGCACAGGCTAAGCTCGAGAGACTTCTGCTCCACTCGAACCGCCTTGTGTCTCTGGAT
  TCGGGGCTGTTGAACAGCCTGGGCGCCCTGACGGAGCTGCAGTTCCACCGAAATCACATCCGTTCCATCG
  CACCCGGGGCCTTCGACCGGCTCCCAAACCTCAGTTCTTTGACGCTTTCGAGAAACCACCTTGCGTTTCT
  CCCCTCTGCGCTCTTTCTTCATTCGCACAATCTGACTCTGTTGACTCTGTTCGAGAACCCGCTGGCAGAG
  CTCCCGGGGGTGCTCTTCGGGGAGATGGGGGGCCTGCAGGAGCTGTGGCTGAACCGCACCCAGCTGCGCA
  CCCTGCCCGCCGCCGCCTTCCGCAACCTGAGCCGCCTGCGGTACTTAGGGGTGACTCTGAGCCCGCGGCT
  GAGCGCGCTTCCGCAGGGCGCCTTCCAGGGCCTTGGCGAGCTCCAGGTGCTCGCCCTGCACTCCAACGGC
  CTGACCGCCCTCCCCGACGGCTTGCTGCGCGGCCTCGGCAAGCTGCGCCAGGTGTCCCTGCGCCGCAACA
  GGCTGCGCGCCCTGCCCCGTGCCCTCTTCCGCAATCTCAGCAGCCTGGAGAGCGTCCAGCTCGACCACAA
  CCAGCTGGAGACCCTGCCTGGCGACGTGTTTGGGGCTCTGCCCCGGCTGACGGAGGTCCTGTTGGGGCAC
  AACTCCTGGCGCTGCGACTGTGGCCTGGGGCCCTTCCTGGGGTGGCTGCGGCAGCACCTAGGCCTCGTGG
  GCGGGGAAGAGCCCCCACGGTGCGCAGGCCCTGGGGCGCACGCCGGCCTGCCGCTCTGGGCCCTGCCGGG
  GGGTGACGCGGAGTGCCCGGGCCCCCGGGGCCCGCCTCCCCGCCCCGCTGCGGACAGCTCCTCGGAAGCC
  CCTGTCCACCCAGCCTTGGCTCCCAACAGCTCAGAACCCTGGGTGTGGGCCCAGCCGGTGACCACGGGCA
  AAGGTCAAGATCATAGTCCGTTCTGGGGGTTTTATTTTCTGCTTTTAGCTGTTCAGGCCATGATCACCGT
  GATCATCGTGTTTGCTATGATTAAAATTGGCCAACTCTTTCGAAAATTAATCAGAGAGAGAGCCCTTGGG
  TAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_004488
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_004488.2, NP_004479.1
• RefSeq Size: 3493 bp
• RefSeq ORF: 1683 bp
• Locus ID: 2814
• Cytogenetics: 3q29
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: ECM-receptor interaction, Hematopoietic cell lineage
• Gene Summary: 'Human platelet glycoprotein V (GP5) is a part of the Ib-V-IX system of surface glycoproteins that constitute the receptor for von Willebrand factor (VWF; MIM 613160) and mediate the adhesion of platelets to injured vascular surfaces in the arterial circulation, a critical initiating event in hemostasis. The main portion of the receptor is a heterodimer composed of 2 polypeptide chains, an alpha chain (GP1BA; MIM 606672) and a beta chain (GP1BB; MIM 138720), that are linked by disulfide bonds. The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX (GP9; MIM 173515) and GP5. Mutations in GP1BA, GP1BB, and GP9 have been shown to cause Bernard-Soulier syndrome (MIM 231200), a bleeding disorder (review by Lopez et al., 1998 [PubMed 9616133]).[supplied by OMIM, Nov 2010]'