Parkin (PARK2) (NM_004562) Human Untagged Clone

CAT#: SC303500

PARK2 (untagged)-Human parkinson protein 2, E3 ubiquitin protein ligase (parkin) (PARK2), transcript variant 1


  "NM_004562" in other vectors (6)

Reconstitution Protocol

USD 780.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "PRKN"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PRKN
Synonyms AR-JP; LPRS2; PARK2; PDJ
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_004562 edited
GCCACCATGATAGTGTTTGTCAGGTTCAACTCCAGCCATGGTTTCCCAGTGGAGGTCGAT
TCTGACACCAGCATCTTCCAGCTCAAGGAGGTGGTTGCTAAGCGACAGGGGGTTCCGGCT
GACCAGTTGCGTGTGATTTTCGCAGGGAAGGAGCTGAGGAATGACTGGACTGTGCAGAAT
TGTGACCTGGATCAGCAGAGCATTGTTCACATTGTGCAGAGACCGTGGAGAAAAGGTCAA
GAAATGAATGCAACTGGAGGCGACGACCCCAGAAACGCGGCGGGAGGCTGTGAGCGGGAG
CCCCAGAGCTTGACTCGGGTGGACCTCAGCAGCTCAGTCCTCCCAGGAGACTCTGTGGGG
CTGGCTGTCATTCTGCACACTGACAGCAGGAAGGACTCACCACCAGCTGGAAGTCCAGCA
GGTAGATCAATCTACAACAGCTTTTATGTGTATTGTAAAGGCCCCTGTCAAAGAGTGCAG
CCGGGGAAACTCAGGGTACAGTGCAGCACCTGCAGGCAGGCAACGCTCACCTTGACCCAG
GGTCCATCTTGCTGGGATGATGTTTTAATTCCAAACCGGATGAGTGGTGAATGCCAATCC
CCACACTGCCCTGGGACTAGTGCAGAATTTTTCTTTAAATGTGGAGCACACCCCACCTCT
GACAAGGAAACATCAGTAGCTTTGCACCTGATCGCAACAAATAGTCGGAACATCACTTGC
ATTACGTGCACAGACGTCAGGAGCCCCGTCCTGGTTTTCCAGTGCAACTCCCGCCACGTG
ATTTGCTTAGACTGTTTCCACTTATACTGTGTGACAAGACTCAATGATCGGCAGTTTGTT
CACGACCCTCAACTTGGCTACTCCCTGCCTTGTGTGGCTGGCTGTCCCAACTCCTTGATT
AAAGAGCTCCATCACTTCAGGATTCTGGGAGAAGAGCAGTACAACCGGTACCAGCAGTAT
GGTGCAGAGGAGTGTGTCCTGCAGATGGGGGGCGTGTTATGCCCCCGCCCTGGCTGTGGA
GCGGGGCTGCTGCCGGAGCCTGACCAGAGGAAAGTCACCTGCGAAGGGGGCAATGGCCTG
GGCTGTGGGTTTGCCTTCTGCCGGGAATGTAAAGAAGCGTACCATGAAGGGGAGTGCAGT
GCCGTATTTGAAGCCTCAGGAACAACTACTCAGGCCTACAGAGTCGATGAAAGAGCCGCC
GAGCAGGCTCGTTGGGAAGCAGCCTCCAAAGAAACCATCAAGAAAACCACCAAGCCCTGT
CCCCGCTGCCATGTACCAGTGGAAAAAAATGGAGGCTGCATGCACATGAAGTGTCCGCAG
CCCCAGTGCAGGCTCGAGTGGTGCTGGAACTGTGGCTGCGAGTGGAACCGCGTCTGCATG
GGGGACCACTGGTTCGACGTGTAG
Restriction Sites Please inquire     
ACCN NM_004562
Insert Size 1500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004562.1, NP_004553.1
RefSeq Size 2960 bp
RefSeq ORF 1398 bp
Locus ID 5071
Cytogenetics 6q26
Protein Pathways Parkinson's disease, Ubiquitin mediated proteolysis
Gene Summary 'The precise function of this gene is unknown; however, the encoded protein is a component of a multiprotein E3 ubiquitin ligase complex that mediates the targeting of substrate proteins for proteasomal degradation. Mutations in this gene are known to cause Parkinson disease and autosomal recessive juvenile Parkinson disease. Alternative splicing of this gene produces multiple transcript variants encoding distinct isoforms. Additional splice variants of this gene have been described but currently lack transcript support. [provided by RefSeq, Jul 2008]'
Transcript Variant: Transcript variant 1 represents the predominant and full-length form of this gene. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.