SULT2B1 (NM_004605) Human Untagged Clone

CAT#: SC303504

SULT2B1 (untagged)-Human sulfotransferase family, cytosolic, 2B, member 1 (SULT2B1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SULT2B1
• Synonyms: ARCI14; HSST2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_004605, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGTCTCCCCCACCTTTCCACAGCCAGAAGTTGCCAGGTGAATACTTCCGGTACAAGGGCGTCCCCT
  TCCCCGTCGGCCTGTACTCGCTCGAGAGCATCAGCTTGGCGGAGAACACCCAAGATGTGCGGGACGACGA
  CATCTTTATCATCACCTACCCCAAGTCAGGCACGACCTGGATGATCGAGATCATCTGCTTAATCCTGAAG
  GAAGGGGATCCATCCTGGATCCGCTCCGTGCCCATCTGGGAGCGGGCACCCTGGTGTGAGACCATTGTGG
  GTGCCTTCAGCCTCCCGGACCAGTACAGCCCCCGCCTCATGAGCTCCCATCTTCCCATCCAGATCTTCAC
  CAAGGCCTTCTTCAGCTCCAAGGCCAAGGTGATCTACATGGGCCGCAACCCCCGGGACGTTGTGGTCTCC
  CTCTATCATTACTCCAAGATCGCCGGGCAGTTAAAGGACCCGGGCACACCCGACCAGTTCCTGAGGGACT
  TCCTCAAAGGCGAAGTGCAGTTTGGCTCCTGGTTCGACCACATTAAGGGCTGGCTTCGGATGAAGGGCAA
  AGACAACTTCCTATTTATCACCTACGAGGAGCTGCAGCAGGACTTACAGGGCTCCGTGGAGCGCATCTGT
  GGGTTCCTGGGCCGTCCGCTGGGCAAGGAGGCACTGGGCTCCGTCGTGGCACACTCAACCTTCAGCGCCA
  TGAAGGCCAACACCATGTCCAACTACACGCTGCTGCCTCCCAGCCTGCTGGACCACCGTCGCGGGGCCTT
  CCTCCGGAAAGGGGTCTGCGGCGACTGGAAGAACCACTTCACGGTGGCCCAGAGCGAAGCCTTCGATCGT
  GCCTACCGCAAGCAGATGCGGGGGATGCCGACCTTCCCCTGGGATGAAGACCCGGAGGAGGACGGCAGCC
  CAGATCCTGAGCCCAGCCCTGAGCCTGAGCCCAAGCCCAGCCTTGAGCCCAACACCAGCCTGGAGCGTGA
  GCCCAGACCCAACTCCAGCCCCAGCCCCAGCCCCGGCCAGGCCTCTGAGACCCCGCACCCACGACCCTCA
  TAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_004605
• Insert Size: 1053 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_004605.2, NP_004596.2
• RefSeq Size: 1281 bp
• RefSeq ORF: 1053 bp
• Locus ID: 6820
• Cytogenetics: 19q13.33
• Domains: Sulfotransfer
• Protein Pathways: Androgen and estrogen metabolism, Sulfur metabolism
• Gene Summary: 'Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene sulfates dehydroepiandrosterone but not 4-nitrophenol, a typical substrate for the phenol and estrogen sulfotransferase subfamilies. Two alternatively spliced variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (1), also known as SULT2B1a, differs in the 5' UTR and in the coding region when compared to variant 2. The resulting protein (isoform a) has a shorter and distinct N-terminus compared to isoform b.