VCY (NM_004679) Human Untagged Clone
CAT#: SC303519
VCY (untagged)-Human variable charge, Y-linked (VCY)
"NM_004679" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | VCY |
Synonyms | BPY1; VCY1; VCY1A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_004679, the custom clone sequence may differ by one or more nucleotides
ATGAGTCCAAAGCCGAGAGCCTCGGGACCTCCGGCCAAGGCCAAGGAGACAGGAAAGAGGAAGTCCTCCT CTCAGCCGAGCCCCAGTGGCCCGAAGAAGAAGACTACCAAGGTGGCCGAGAAGGGAGAAGCAGTTCGTGG AGGGAGACGCGGGAAGAAAGGGGCTGCGACAAAGATGGCGGCCGTGACGGCACCTGAGGCGGAGAGCGGG CCAGCGGCACCCGGCCCCAGCGACCAGCCCAGCCAGGAGCTCCCTCAGCACGAGCTGCCGCCGGAGGAGC CAGTGAGCGAGGGGACCCAGCACGACCCCCTGAGTCAGGAGAGCGAGCTGGAGGAACCACTGAGTAAGGG GCGCCCATCTACTCCCCTATCTCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_004679 |
ORF Size | 378 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_004679.2, NP_004670.1 |
RefSeq Size | 551 |
RefSeq ORF | 378 |
Locus ID | 9084 |
Gene Summary | The protein encoded by this gene is a member of a family of human VCX/Y genes. This gene family has multiple members on both X and Y chromosomes, and all are expressed exclusively in male germ cells. Members of the VCX/Y family share a high degree of sequence identity, with the exception that a 30-bp unit is tandemly repeated in X-linked members but occurs only once in Y-linked members. VCX/Y genes encode small and highly charged proteins of unknown function. This gene encodes a small, positively charged protein. The presence of a putative bipartite nuclear localization signal suggests that this gene encodes a nuclear protein. The genome has two identical copies of this gene within a palindromic region; this record represents the more centromeric copy. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215150 | VCY (Myc-DDK-tagged)-Human variable charge, Y-linked (VCY) |
USD 98.00 |
|
RG215150 | VCY (GFP-tagged) - Human variable charge, Y-linked (VCY) |
USD 460.00 |
|
RC215150L1 | Lenti ORF clone of Human variable charge, Y-linked (VCY), Myc-DDK-tagged |
USD 768.00 |
|
RC215150L2 | Lenti ORF clone of Human variable charge, Y-linked (VCY), mGFP tagged |
USD 620.00 |
|
RC215150L3 | Lenti ORF clone of Human variable charge, Y-linked (VCY), Myc-DDK-tagged |
USD 620.00 |
|
RC215150L4 | Lenti ORF clone of Human variable charge, Y-linked (VCY), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review