GOSR1 (NM_004871) Human Untagged Clone

CAT#: SC303541

GOSR1 (untagged)-Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 1


  "NM_004871" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "GOSR1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GOSR1
Synonyms GOLIM2; GOS-28; GOS28; GOS28/P28; GS28; P28
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_004871, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCAGGGACCAGCAGTTACTGGGAAGATCTCAGGAAACAGGCTCGACAGCTGGAA
AATGAACTTGACCTGAAACTAGTTTCCTTCAGCAAACTATGTACAAGTTACAGTCATAGC
AGTACCCGAGATGGAAGACGCGACAGGTATAGTTCTGATACAACACCCCTTTTAAATGGA
TCAAGCCAAGACAGAATGTTTGAGACAATGGCGATTGAGATTGAACAACTTTTGGCAAGG
CTTACAGGGGTAAATGATAAAATGGCAGAATATACCAACAGTGCAGGTGTCCCCTCCTTG
AATGCAGCCCTGATGCATACATTACAGCGGCATAGAGACATATTGCAGGATTATACACAT
GAATTCCATAAAACCAAAGCAAACTTTATGGCAATACGGGAAAGGGAGAATCTTATGGGA
TCAGTACGAAAAGATATTGAGTCATATAAAAGTGGGTCTGGAGTAAACAACAGAAGAACT
GAGCTATTTTTGAAAGAACATGACCACCTTCGAAACTCAGATCGTCTGATAGAAGAGACA
ATAAGCATTGCTATGGCAACAAAAGAAAATATGACTTCACAGAGAGGAATGTTGAAGTCA
ATTCACAGCAAAATGAACACTTTGGCCAATCGTTTTCCTGCTGTAAACAGCCTGATCCAG
AGGATCAACCTGAGGAAGCGGCGGGACTCGCTCATCCTAGGGGGTGTTATTGGGATCTGT
ACCATCCTGTTGCTGCTGTATGCGTTCCATTGA
Restriction Sites Please inquire     
ACCN NM_004871
ORF Size 753 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_004871.2, NP_004862.1
RefSeq Size 5230
RefSeq ORF 753
Locus ID 9527
Protein Families Druggable Genome, Transmembrane
Protein Pathways SNARE interactions in vesicular transport
Gene Summary This gene encodes a trafficking membrane protein which transports proteins among the endoplasmic reticulum and the Golgi and between Golgi compartments. This protein is considered an essential component of the Golgi SNAP receptor (SNARE) complex. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.