GOSR1 (NM_004871) Human Untagged Clone
CAT#: SC303541
GOSR1 (untagged)-Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 1
"NM_004871" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GOSR1 |
Synonyms | GOLIM2; GOS-28; GOS28; GOS28/P28; GS28; P28 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_004871, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCAGGGACCAGCAGTTACTGGGAAGATCTCAGGAAACAGGCTCGACAGCTGGAA AATGAACTTGACCTGAAACTAGTTTCCTTCAGCAAACTATGTACAAGTTACAGTCATAGC AGTACCCGAGATGGAAGACGCGACAGGTATAGTTCTGATACAACACCCCTTTTAAATGGA TCAAGCCAAGACAGAATGTTTGAGACAATGGCGATTGAGATTGAACAACTTTTGGCAAGG CTTACAGGGGTAAATGATAAAATGGCAGAATATACCAACAGTGCAGGTGTCCCCTCCTTG AATGCAGCCCTGATGCATACATTACAGCGGCATAGAGACATATTGCAGGATTATACACAT GAATTCCATAAAACCAAAGCAAACTTTATGGCAATACGGGAAAGGGAGAATCTTATGGGA TCAGTACGAAAAGATATTGAGTCATATAAAAGTGGGTCTGGAGTAAACAACAGAAGAACT GAGCTATTTTTGAAAGAACATGACCACCTTCGAAACTCAGATCGTCTGATAGAAGAGACA ATAAGCATTGCTATGGCAACAAAAGAAAATATGACTTCACAGAGAGGAATGTTGAAGTCA ATTCACAGCAAAATGAACACTTTGGCCAATCGTTTTCCTGCTGTAAACAGCCTGATCCAG AGGATCAACCTGAGGAAGCGGCGGGACTCGCTCATCCTAGGGGGTGTTATTGGGATCTGT ACCATCCTGTTGCTGCTGTATGCGTTCCATTGA |
Restriction Sites | Please inquire |
ACCN | NM_004871 |
ORF Size | 753 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_004871.2, NP_004862.1 |
RefSeq Size | 5230 |
RefSeq ORF | 753 |
Locus ID | 9527 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | SNARE interactions in vesicular transport |
Gene Summary | This gene encodes a trafficking membrane protein which transports proteins among the endoplasmic reticulum and the Golgi and between Golgi compartments. This protein is considered an essential component of the Golgi SNAP receptor (SNARE) complex. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214898 | GOSR1 (Myc-DDK-tagged)-Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 1 |
USD 420.00 |
|
RG214898 | GOSR1 (GFP-tagged) - Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 1 |
USD 460.00 |
|
RC214898L3 | Lenti-ORF clone of GOSR1 (Myc-DDK-tagged)-Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 1 |
USD 620.00 |
|
RC214898L4 | Lenti-ORF clone of GOSR1 (mGFP-tagged)-Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 1 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review