CSAG2 (NM_004909) Human Untagged Clone

CAT#: SC303544

CSAG2 (untagged)-Human CSAG family, member 2 (CSAG2), transcript variant 2


  "NM_004909" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CSAG2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CSAG2
Synonyms CSAG3B; CT24.2; TRAG-3; TRAG3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_004909 edited
ATGTGGATGGGCCTCATCCAATTAGTTGAAGGTGTTAAGAGAAAAGACCAAGGTTTCCTG
GAAAAGGAATTCTACCACAAGACTAACATAAAAATGCACTGTGAGTTTCATGCCTGCTGG
CCTGCCTTCACTGTCCTGGGGGAGGCTTGGAGAGACCAGGTGGACTGGAGTATACTGTTG
AGAGACGCTGGTCTGGTGAAGATGTCCAGGAAACCACGAGCCTCCAGCCCATTGTCCAAC
AACCACCCACCAACACCAAAGAGGTTCCCAAGACAACTCGGAAGGGAAAAGGGACCCATC
GAGGAAGTTCCAGGAACAAAAGGCTCTCCATAA
Restriction Sites Please inquire     
ACCN NM_004909
ORF Size 333 bp
Insert Size 333
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced, and found to be a perfect match to the published NM_004909.1
Reference Data
RefSeq NM_004909.1, NP_004900.1
RefSeq Size 799
RefSeq ORF 333
Locus ID 728461

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.